Description :
From Genome Similarity Track
Location :
Scaffold_2071:1- 2033
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2071-fgenesh-gene-0.1GTPase
Pytiw_DAOMBR242034maker-piw_contig_2071-snap-gene-0.6Ser/thr protein kinase

Sequence
2032 bases(100 bases per row)
GGCAAGCCGGGCCTGGGCAACCGCATCCTGGCCGGCAAGACGACCAACTTTGGCCGCCTGCGCAAGCACATGCCGGACAACAAGGGCACGGGCTCACCCG
GCACGTCGCAGTACTACGAGCTCGAGCTCAAGACGATCGCTGACGTCGGGCTCGTCGGGTACCCGAACGCCGGCAAGTCGACGTTGCTGAGCACGCTCAG
CCGCGCGACGCCCGAGATCGCGCCCTATCCGTTCACGACGCTGCACCCGTACGTGGGCATCGTCGAGTTCCCAGACACGTACCGCCTCAGCGTGGCCGAC
ATCCCAGGGCTCATCGAGGGCGCGCACCGCAACGTCGGCCTCGGCCACGATTTTCTGCGCCACATCGAGCGCACTAAGGTACAGTACAGTATACACATGG
GTACACAAATGACTGGCTGTCGTGGCTCGGCTCGGAATGCTAATGAAATGTGTGTGCATTAGATCCTGATGTACGTCGTGGACACGGCCGGCACGGAGGG
CCGCGATCCGATCAGCGACTTCATGCACCTGCAGCGTGAGCTTGAGCTCTACGCGCCGGACATCACGACGCGCCCGTCGCTCATCATTGCCAACAAGATG
GACGAGGCCGGCGCCGAGACGAACCTGCACAAGCTGCGCAAGGCCACGGACTTGGCCGTTCTCCCCGTGAGGTAGGCGCTCTTTGGTGCTCGATACTGGC
GGTGGCGATGAGATTGTAACTGTGATTTCGTGATTCTGTGGCTATAGTGCGCTGCACAAGCTCGACATTGACTCGGTCGCGCGCACGCTGCGCTGGATGA
TGGAGAACTACGCCAAGCTCACCAAGTCGGTTTAGAGAACCAACCCTGTCGTAGACGAATAGCGGGTGGCATGCTCGACAACATAAATTCAGAACTTTCA
GCCCCAATGTCCACAATATCCGCAAGCTACCCGTGGTCAAAATTGGTCGTGCTGAATATCTTGTTCGTGTGCGTGGCAGGCTTGAGACTTAAAACAGCAA
GAAACAAGCGGTTGTCTGACCTCCCAGAGTATTTGCAGTCGAACTATTTCAGTTCCTGAGACAGCAGACAGACAATTATAGCTTCAGCCCAGTCGGAGCG
CTGGCTGGGAGCCCTCTTTCCCAAGTCTCTCAGGCTATCGTGACATCAAGCCAACCTCCAGCAGATAGACAGACAGTCGAGATGCACCGGTATGAGATGC
TCGAGCAGCTCGGCAACGGGTCCTTCGGGGAGGTAGTGCGCGCGCGCAGCCTCAAGACGAACGAGGTGGTGGCGATCAAGAAGATGAAGGCGCTCTTCCC
GACGTGGGAGGAGTGTCTCCAGCTGCGCGAGCTCAAGTCGCTCCGTGTGTTGCGCCACGAGAACATTGTGCAGCTCAAGGAGGTGATCCAGGACAAGGAG
GAGCTCTACTTTGTCTTTGAGTACATGCACTCGTCGCTCTGCAAGGTCATGCGGCAGGTACGGCTCCAGGCTCCCTCGGGCTCAGCCTCAGGCCTAGATG
AGCCCACTGCTGGAGCTGCTGGCTCGTCAGTAGCTCCGTTATCACCACCGACAGCGCCAGGCTCTTGGCTCTCGGAGGCGCAGATCCGCTCCATCATGTA
CCAACTCTTCTGTGGCCTCGCACACATGCACAAGCACGGCTTCTTCCACCGCGACATCAAGCCCGACAACCTCCTGTGCCACGACGAGACGCTCAAGATC
GCCGACCTGGGCCAGGCGCGCGAGATCCGCTCGCGTCCGCCGTACACGGACTACGTGGCCACGCGCTGGTACCGGAGCCCCGAGCTTCTATTGCGCGCGA
CGACTTATAACAGCCCCATCGACTTGTGGGCTTGTGGTTGCATCATGGCCGAGCTCTTTCTCCAGGTGCCGCTCTTTCCAGGTACCTCTGAGGCCGACCA
GATGTGCCGCATCTGCAAGGTGCTGGGCACACCCACCAAGGAGAACTGGCCCGAGGGCATGACGATGGTCTCCCAGATGCAGTTCAAGTTCCCAAAGTGC
GCGCCCGTGCCCTGGAGCCACGTGCTCCCAGG