Description :
From Genome Similarity Track
Location :
Scaffold_1945:1- 2027
Sequence
2026 bases(100 bases per row)
CCCCGAATCAGTGACAATTTCAACCTGATTATAGAGGATTTGGGTTGTTTGGCACGGGTGCCAGTTGCCTGTGGTGGATTAGCCATGGCGAGCAGCACCC
CGTATGGAATGACGATGGATCTGATATGAGCGATGTACGAGAAGGCAAGATCCACCAAGACTTACCTCGGATCCACCCTTACTTGGATTCACCTAAATGG
ATATGGGATATACTATACAAGAGTGGATCGGGTGTGGATCCTATGAAGGAAGGATGGTAGGTGCCCTCTAAAGGTGGATCTAGTAGCCACGGCTAACGAG
GAGTCAAGATCCACCGCGAGGTGACCCGGATCCCATGCTTTCGAGTTAGGATCCAAGGAGGGAGGATCCCGCCTTAAGGGACCTGGATCCAGGGTATAGG
TATGATGGATGCAGTGGATCTAGAACTTTCGTGGGACAGTGGAGATCACAGACGGTTGCGAGATGATGTTGGATGAGTGGAGAGCTCAGATCCACGACGA
GTGTACACTTTTCAAGTGAAGTGGATCCAAGCGACCTGGATCCTGATGAGTGTACCCATAATAGGGTAACCCATAATGATTACGCCATGGATCCGGTGGA
TCTGAAGATAATACAGCTGGGATAATGGGTCAAGGGAAGAAGGGACATCCAGCCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATAGAAGGTAGAAA
CCCAGGCAGGTATAGGCTTAAATATCAATACAGACTCCAATTTGCACAGTGACACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCCGTA
CGAGCTCCGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTTTACT
TGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCTAGGGGCTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGAC
TTAAAGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTA
GGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACT
CTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCATCCGTTA
GTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACACTGCCCAGCGCATGCTTCGGGGTACGGT
GGTGGCACCCGTAAACCATGGAGCGGCCATCAACTCAAGAGGTTATTGGCCTCCCAGAGGAGAGCTCTGGGGATGACCTCTTTCTGGAGATCCTCGTCGC
TCCTCGTGGCCTTGTCGGTAGTCACATTTCTAAGTCCGTTTACGAACGTGCCCTGGTTAAGAAGGAGCAGTTGTTCGCCGACAACTTGGAGGCGGCCCGG
TGCGTTTTTCTCGCGCCACACCGCATTCCCCTTAAGGACTTCACGACCTGTCGTAAAAAGCCCGAGACCCGGGGTGGTCTCTATCCTCTTTGGGGATACC
CCTGGGTTATGCCCGAGAGCTGTCCTACCTTGAGTTCTTGTGAGGACATGTTCTGGGCATGGGTGGGGACGCTTAAGTACTCACCCACGGAGTTACGGGA
ACTCCATGAAGATCAGCTGCTGTCCCGCATCCTGGACCAGCGTGATCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCGCATGCTGCCAAGGGACATC
CTGAAGCGCGCGGCGTCTAACGCTCACGATGAGCGCGGGTACGGAATGTATTTATCGTCCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAG
CTGCCGCTGCTTCTGTTCCCAGATTG