Description :
From Genome Similarity Track
Location :
Scaffold_2064:1- 2024
Sequence
2022 bases(100 bases per row)
TTGGATGCTTTTGTTAAGAACTTCAACAAGATGCCGGCTGCTTACCGTGAGCGGGTTAAGCACGCCCGTGAACGCTTCGAGACATTCTCGACGCGCGGGA
GGTTGGAGCAGCTCCACAGATCTTCTGTGGACGCTGGTATTCCATGCGCTGTGCCTGAAGGCCAACAGTGCACGTTGTGTCTTCCGGGTGCGGCGCGCTT
GAGCGACCGCGACCTAAACGGGTACACGACGATTCGTGTACCTGCGAGTCTCAAGGATCTCCGTGCCAAGTTCTTGGCACGTGAGGAACGCGACGATCGT
GGGACCTCGGGCGCTGTAGGTGACCACAGCGCTCGCACTACCTTCGCGTCGGCAGTGCGTGGTGAGCTTCGTACACCTTCACCATTTCCGGAACGTCCTG
CAGCAGGACGTCCCGTGGCTCCCATGTATCTTGGTGGGGCGGAAACCCTCTCCAACAAATACGATAACGAACCGGCTGCCGGTTCGTTTTCGGGATACTA
TGGTTCACAATACGCTCAACAATCCAGCGTGTTGAGCCGCGGGCGTCGCGGATCGGAGGCGGCGGTGGTGGGAACACGCTCCGGGTATGGCCAACCTGGG
GTTGACCTTGCCCGACGCTCGAGGAGCGGGTCGCTGCTGTGGAGCAGCTTCAGAGCCGTGAATTCGCCGCTCTGAAGCAGGAGATGGCGACCCTGAGAGC
TCAAGTTGCTCAGGCCTCGCAGACCGCGTCGGACATCTCTGTCGACGTGGGAGGTCGCGTCGTGCGCTTGGCACAGCGCGTTCACGCGTTGGAGCAGAGG
TTCGCTCCCGCTGGGGCTTCCGCTTCGGGCCAGCCGAGCTAGGTGACTCGTGCTGCCGGTATGGTTTCAGCCGCCCGACGTAAAAGGTCGGATGGAGGCG
CATGCTAGATGGAATATCTAGCGTGTAGGCGTTGCCATGCCGTGCCAACACCGTGAACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCG
GAAACTGCATGTTTAGGCAGGTTTTGAGTTGCTAACAAAACCAATGAACCCTTCTTGAATTCATTAGTGTTGCCCCTACCAACATTGTCTGCGTTCAGCT
TCTGTCGGCCGACAGAAGCTGCAATAGCGTCTTGGACAAACCGAATGATGGCTTGTCTGCGCTGCACGAAGTTGATTGCGTCCGAGATGAACTCGTTCAG
CTCGTTTCTAGCAGTAGGCCCGGCCTCTGCGTTCGTCTTCGCGGTGTCTGTGCCCTGCACAGGCCCGTTCTTCTTCTTCTTCTTCTTGCTCTTGTCGGCG
TCTGTGCCCTGCACAGACGCGTGCTTCTTCTTCTTCTTGCGCGTAGTCGCGGCTGACACTGTGCAAGTGTCAGCGGCATTCTGTGGCTGCTGCGTTGCAG
TCGTAGATCCTCCCCCACTTAGGGAAGGAGCCACCATCCCGAGTAGACTCGGGAGGCGTGGGGGCCTGATGGCATTCACGTAGAACGGTGTATGCCCGGT
CGAGGCATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAGGCACTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCTTTTATGCACGTCTACGAGC
ACGCGGTTCACGCGCTCGGTCTGCCCGTCCGCCTGCGGATGGTCCGCACTCGACATCGAAAGTTGACTCCCAAGAAGTGTAAACACTTCTTGCCAAAGGT
GTGCAGTGAAGCGCGGGTCTCGATCCGACACAATGTCGATCGGCATGCCATGGTGTTTGAACACCATGTCAACGAACAGACGCGCCGTCTGTTTCGCAGT
CACTTCAGCGGGTACCGCAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAACGCCCGTGTTCCCCTGGCTGTCCGGNGGAAGACCGAAC
ACGAAGTCCAAGGACATGGACTGCCAACACTCCCGTGGAGTTGGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACACGTTGACAAACCT
CGCAAGCACGGACGTACATACG