Description :
From Genome Similarity Track
Location :
Scaffold_317:1- 2011
Sequence
2010 bases(100 bases per row)
CGCGCTGCTATTTCCTGCTCTCTTCTCACGTCTTCTTCGCGCACCTGCTGCAAGGCACTCAGCTTCTCCCTCACTGAACAAAGTTGTTGACTCACTTCGA
GATACTCTGCCTTCAAGTTGCTCACCACCACGTCGGAGCAACCTGCCTCATTCGTCGTCTCTGGGAGTTGAAGGCAGTCGCTTTTAATCTCGAGACTGCA
ATGACTATTGTGGCGAGAGCTCAGTTTCCCTGGTCCCATCGATAAGCTGCTCCTACGTCGAGGCTGTTTCGCTAGAGAGAGATTTCCAAGGCTCTTCGAT
CGCTCCTCGAGGTTACCGGTAGTGTTTACGAGCCCAGAGTTGATATCGGCCAGTGTCAGAGTCAATGCCGGTTTCGCGTCTCGCATCCTAGTGGCAGACA
ACAGACAAAGCGAGAAACATTACATCCCAATCCTAGCAAAATACGATGGGAAACGCACCCTTACTTACATTTGGAGGACGTCAGCATAGGCTATGTTGGC
TACATCATGCTCGTTTACCATACGCACCCGCAACTTGTCCACAATGATCCGCGAATAATCACCTGCGGCACGACAGCGTGCGTTGTAGTCTGCTGCGAGC
CCCACAGGGGCCACATCATGAACGACACAAGCATAGCTTTCGGTGGGAACAAGGCTAAACCTGTTGCATTTCGAAGCAGGCTGGAAGCCGAGGCCCACCG
GCTTGCTGTCATCGAAGAATACGCTGAATTCCTTCTCCCACCGATTGGGGTCTTCGCTTTGCTTTGCTCGAAAAGCAGCGACCAACAGGTCATCCCACGC
TCTCTCCGCACAAGATCGTTGTCCTTCAGTAGAACGGTCGTCCTCTGAATCGTGGTTGCTTGGAGGTGGGGCAGCAGGAGGTTCCTCAACCCACGGAGGG
CTGCAGAATTTAAACACCATTGCTGCCTGCGCCCACAGCGCGAACTTCTTCCTGGGTCAGTTGCAAAATGATCGTATGCTCATGCTGAACAACATGTCAA
AAACCACCACAACCGCTCGCCATAATTAGCAAGCCGAGTACCTGAGCTGCAAATAAAAACATGTTTTGAGTTAGAGAAAAGGTATACGCACTCCACTTTA
TGTCTCCGTCTACAGCTTCAATCACAGTTTCCTCAGGATAATGCAGCACTTATTGCTGCGGAGAGCAACCAGGCACACGGCACGTCGCACCCGCTGAGCA
TGTGGGGGCATGCGCCCGCACAATAGACCTCCAGAGCTTACACGCGCCGCACCTTTTTGAATCATGCGTTGCATTGACTGCCATCGCCGAGCGATGCGCT
TTCACTTTATCCACAAAAGTGCGCGTTGAAACACACAGTGGATTTGAACACCCACAGGTATTACACGTCGAAAGATGCTGCAGCCCACGAAGCATCGACT
GCATCTGGGCAGCCCCAGGTGTCGTCGCCGTCTTTGCACGAGGCATTTTCTTGCCATCAGAGACTTCTCCTACCGACGTGGGGCTCAGTGGCTCACGGCG
TAGCCGCTTGGTCGCTGGTGGTACTGGAACCTGACGCCTGAAAGCTACTGTTGAGCCGCCTGCTGTTGAGTCGGCGATTGGAGTTTGGCTTACAGTAAAA
GGCGGAGGGAAGAACGACACACGGGGCGACGCGAACGCGACGCGAGACGAGCTGACAGGCGGCAACGGGGGCGAGTCACCGCTATGGCTGCGCTTGCGCG
AGAGTCCATGGGCGGAGGAGACGATCTGCGAGCGCGAGATGGAGTAGGACAGCGGACGCGACAACGACGAAAACGAGAGGGCGGGGAGGGCAGACACAGC
GTCTCGATCAGTCCCGCCGTTCGTAGGAAGGCTCTGCGCAGCCACACGAGGGTGAGAAGGATGCAACTTCAATAGAGGAGGCAGACGCACCATTTCAGTT
TCAGCTCCATCGGGTACGAGGAGAAGACGCGCCAGCTTCACGACGCGACAGATTACGCGCGTCTACTGACGGAGAGGCAAAGGAAGGCGAACGGAGGAGG
AAGGAGGCGA