Description :
From Genome Similarity Track
Location :
Scaffold_3190:1- 2011
Transcript NameFunction/comments
Phypl_g15673hypothetical protein

Sequence
2009 bases(100 bases per row)
GCGCTGAAGTCTCAATTATAGACACCACCTTTGCTCGTAAGGTTGGGTGTGTCATAGACGAAAGTCAGAGCAAGAGTGCGTCGGAATCGGAGAGAACACG
TAAATGACGGTTGGATGTACCACGGTCAAGGTCACGCTGGCTGGATCGTTGGTGTACTACTTCGACACTTGAGTTGGCGATCAGTCGGGGCAGGAAGCGA
TACTCGGTATGGACTTCATGGTACCCGCTGAAGTGCGCCTCGATCTAGCTGATGGGACGTTCTGTCTCCCTAATGAGGTGCTGATTCAGCTGCTAGGACG
GCGTCAGCTGTACGGAGCTAATGTCCAGCCCGTCACGCTTGATCAAAGATCTTGAAGTGCCAGTCGCCGAGTCCGTGGAGATCCCGATCCGGTATGGCCG
ATCGGCCACAGCAAGGCTCTGGATCACACGAGGTCCAAGATGGGTGCCGACCGCTGTCAAGGGTCTGGGCCGGACGAGGCATCTGCGGATCACAAATGTG
AGTAAAGAGATGTTAGTACTCGATCGACACGAACGTTTGGGAATCTGGCTAGCCCCAGACGCCGTACCTCGCATGCCGGAGTTTGTGCCAGTCGGATCGC
GCAGATACGCTGAATGGCAGAACCTTGCGTTCGAGGCTACCACTGATCGACAGGAGGAACCAggacgcgaagaagagccAGTGGAACCGCTGGTGGATCG
GCCTCGATatccgacgccgacgcgaaTTCTGAGTCGGTCGGATGGGCCTCCTAAACCAGTGGTGGCCGTAGCAACAGCCTTACCGTCGACCTGCGAAGGA
ACACGGGAAGGCCTGCCGAAAGCCGAAGTGAAGTGTGAAGAGCcggacgaagagcgagtCGCCCGGGAGCCTGCATCGATCCAGAAAGAGGAGTCGAGCT
CGGAAGAAGCTATGGCAGAACAGGTCTGCTACCATGAGGGCGGATGCTTTGTCGAAGAAGATCTCGATCGGGACTTGGCCATCTTGCCCGAGGTAGCGGC
TTCGACCGAAGACGTAACGATCGAAGACATTCAGGTCGGCGATCCCGATCTGAATAACCCGGATGAGATCGATCGGCTGCGACGGATCatctggagaagg
cggcACCTGCTGATCGGCAAAAGAAACGCCCTGCCACCTGCGGCACGTGGTGCAGTGTGCGACATCGACGTTGGTGGTATCACTCCAGTAGCCCAGTGTG
TGCGACCGGTTGCTACACAATTTCGAGAGAAGTTGGCTGCGCTGATCAATGGTTTGCTGTGGGCTAGGATCATCAAGCACTTGACCTCACCGTGGGCATC
CCCGATCGTGATcatcatcaagaagaacggtGTTGATATACTACTCTGCATCGATTACAGAGTCGTCAACGGCCTGACGTGAANAACGGCCTGACGCGCT
TGATGGTGTATCCGATGCCGCTGATCAACAATCTTCTCGAAGACTTCGATAAGATCTTGTGGTACTGCTCCCTTGATATGGCGAGCGGATTCTGGGTAGT
CTCCATGACCGAGCGGGCGTGGTTGATCGCAGCGTTCATCACCCCGTTCGGGTTGTTCGAGTGGCTGCGTATGCCATTCGGATTGAGAACGCGCCTCAGA
TATATCAGCGACTCATCGGCAACGCTCTGTACGGACACCTCAAGATCAGCTCGGATCCGGATGGGAAGGGGACGAGTGATGTCTTCGAGAGTGGCAAACC
GGACCCCGATCAGAAGCCGTCCGTTCTCGGACGGCGATCgtacatcgacgacatcttAGTGACAGCCAAGTCTTGCGATACCCTCTATACGAAGGTAGAT
CGCCTGCTGGATGCTTGCGAATAGTGGAACCTCTCGATCAGTGTGGTCAAGAGTGTCTGGGGACGGCAGAAGGTCTATTACCTGGGTCATCAGGTATCGG
CAGACGGACTGGAGGCTCACCCCAAAGACCTCGAATCCCTGGCCAATCTCTCTTTCCCGCGTACGCTACGATCGATGCAGTCTTTCTTGGGCAGCTTGAA
CTACTATAG