Description :
From Genome Similarity Track
Location :
Scaffold_3289:1- 1992
Transcript NameFunction/comments
Phyta_totarag15197hypothetical protein
Phyta_totarag15198hypothetical protein

Sequence
1990 bases(100 bases per row)
AGACACCCAAGCACGGGTATCTCGCTCGCCCCGAAGATACACTTCTTCAGGTTTTGTACTTGCACATCAGCTCAAACAGCTTACGGAGCTGCACCTTGTG
CATCTCAACATCCGCCTTCCCGTCCACAGCCCGGCTGTGAACGAATacgtcgtcgaagtactACGGTGTGAAGTCCACACATGTTGAACGTCGCAGGGGC
GTTCTTTAACCCCTGTGGCATGACGAGCCACTNGCGGTCTGCGCCGGTATCGTCGCatcgttcagcttgttgtaCGCATGAACGATGCACCAGCCGCCCT
GTGGTTTCTTGACACAGAACGTCGGTGCACTATGCGGGGACTTGGATTCCCCCACTTGGCCTGCCTTGCGACGACTCTCAATGAAGTCGTCGATTGCCAT
CACTTGGTCTCGCGGCagctgccactgccgcgaGACACAGTACTTCGTGCCCAACACGAGGTCGATCACGTGCTGGATTCCCTTGTCCTGCGGGAGCTCC
GCAAGGATGTCGTCCGGGAGTACGTCCTTGTACTCTCGTAAAATTTCGTAATAGGgactcgacttgagcgagtccCAACTCTGCGCActttcttcacctt
ggcgCTGAGAGTGTCTTCACTCTCAGTGTTACTGCCAGCGAAGAGTTGCTTGAACTCTTCCGCCTCACACTTCAACCTTTCCATGTCTGAAAGGATGCag
atctgctcgatgcgtCCATCGTGCAAGCCGCGCGCGAAGCGCTTCCTGCTCATGACTGGAAGTGACGTCAACTCCGGCGCACTCGTCGGAAGGGTTCTCA
AGGTCATACTTCTGTACTGTAATCCAGTACTGGTCTGCGTCAAGACATTCAATGTCTGCCCGGCAGACATCTGGTTTACCGTCTCCGTCCTGGACCGAGA
CTCGCGCAGTTTCTTCTGCGTACGCTGTCGTGTCTTCCTCTCGCAGAGCCCGGTTCCGCGTGTTCTTCGTCCGTGGGCGGGTTCGTGTTGTCGTCGCCGG
AGGATTCTATCCGCGGGCGCGCGTCATCAAGCCCGGCTTGACGCGCattcgcttcttcgtgcagtcCTGCTGTACGTGAGCTTGCAAGCTTTTCTTGTGC
TGGACGTTTGCAACCGTCCGCATTGCTTGCAGCGTCAACTCCCCGAGCTGACGCGCCTCCGTTGACTCGACGTCTTTCGGTGGAGATTTCTGCCGAATCT
GATCCAATCAGATTCGCGTCACAATGTTCTTTTGTGGTTTAAATCTGAGTTTATCATATTCTCAGTGTCGCTTCCCAGAACCGACACACAATCATTTCCA
ACGACTTCCGAAGTCGTCAGAGCTTTGTTCATTCGCGCTCTGCGCATCGAGCCAGCAGCGTTTAGCGCTGTCTCTTCTGGAAGATCACATGCATCTCGCG
ATGCATGTGTTGCGCTGGCGCAACCGAAGCGTACAATCGCACGCCTCATCCAGTCCATTTTTTGGGTCATGCCGTGCAAACCACGGTatgcccagcacca
agtcgaacttggcgtCTAAATCTAAGATGATAAAGCCTTCAACAAATTTATTTTGTTGATACGAGAAGCGTACGCGTACGACACGCTTCTCGGTCTTCAT
GATGCCACCTGTTgccagtcgtacttccaatacgcttcgaggtgtttgcacctcctcgaagtcaaGACTTGATANCATTGACGCGTGTCCAATGTCGACA
CGCATGACTGCTTCACCAGTAGGGCGCCCCTCGCCTACTGGTTTCGCGCGTTTTGTTAGTGATCGCGGCGATGCAGGGCATCGCCCCGTTGGCCTCTCTG
CCCGTGCACAGATGCTGTGTACTCGCGCGAAAAATGACCGATGCGTCCGCAACGGAAGCATGGTACGTTAGCCGTACGACGTGGTGGGTAACTCCCAGTC
GCCGCGTTTGAGAGGTCCATTGGGATCGGGCCTCTCGTCCTTATCATCGGACGTGGCATCCGTGGCACGTTCACATGCAGTTTAGCCCAC