Description :
From Genome Similarity Track
Location :
Scaffold_871:1- 1991
Transcript NameFunction/comments
g12185.t1hypothetical protein

Sequence
1990 bases(100 bases per row)
AAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCTAGGAA
AGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAGGTACGTGAGCAACTA
CGCGGGCAGGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGC
TTGACTAAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTTCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGTAAC
TCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACCCCTTGCCAT
GAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGATCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATTAAGTCGCCG
CACATATCCCAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTTGAGTACGAACCTGGAAGGTTGAATGTTGTGGCCGACGTGC
GTCAGCGTAGTCGACGACAACGCAGATCGCATTGTCGTGGCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGG
GACATCCTGGCCGTGAGAAGACATACTTGCTTCTCACGCGTGACTACTATTGGAGTCACCAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGCGAGGT
ATGCCAGCGCGTGAAGCCTGCGCCCAACTTGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTT
GGTCTTCCGCAAGACAACATGGCATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGAC
GGCATGTCTGTTTGTTGACCTGGTGTTTAGACACCATAGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAA
GTGTTTACACTTCTTTGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCA
TGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCAGCAACAACTCGGTGCATGTCTCGACAGGACACACACC
GTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATATCGGATAAGCACGCTGATA
CGAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAAGACAGTGTCTACGACGGGCGTAGACACTTTAAACATCAA
CGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGCCGACAAGTC
GTAATTCGGTTTGTCCAGGACGCGATAGCAGCTTCTGTCGATCGACAGAAGCTGAACGCCGATAACACCGGCAGGGGAAACACAAATGAATTCAAAGTTG
GTTCATTAGTTATGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCAATCACCGT
GTTGGCGAAGCATGGCAACGCGTACACACTGGACATACCGTCCAGCATGCGCCTGCACTAAACATTTTACGTTGGGCGACTGAAGCCGTA