Description :
From Genome Similarity Track
Location :
scaffold_2029:1- 1986
Transcript NameFunction/comments
Pl_100171hypothetical protein PHYSODRAFT_462863

Sequence
1984 bases(100 bases per row)
CTCGTGACACAATACTTGGTGCCAGGTACGAGGTCGATCTTGTGCCGAACACCCCGGTCCGGTGGGAGTTGGGATGGTGGGTGTTTCGACACCACATCCG
AGACCTCCTTCACTAAATGATAGACCGAATCCTTCGTGTTCTTGGTGATTTCAGAACCCAAGCGCGTCGCGCGCTGTCTCGTGAACCCCCTCCAGGACAT
CCTCGCCCATGACGGAGGAAAAGTTCAATCCATGAGGGTTAGTCTCCGGCTTAGGAGTACCAACGTTCAATTTATCCGGTCTTCAACTCGGCCAGAAAGC
CCTTCATGGACAGTTCTTCTAGGTTTAACAAAGCTGACACCTCAGGCAGTGCCTCCAGACGGACGGCACCTGCCTTTATCCGACATGCGGTCAACCCGTC
GAAGATGTGATACCGCTCTTCGACCAACCCTGGGTCGTCGGTCTCAGACTTCGAGCGTGGTGCTTCGTTAACTACACGCGAGATACTCATCTCCTATCTC
GGCATGGTCTTCTTGATCTCGCGTGGAAATACAATACCCACGTTGGGGACGTTCTTACCGCTCTCCTAAGCAGCTCCTGCTGCGTGCGGAACTATGTTAT
CCGCCTGTGGAACTATGTTCCAACTTGTGGATCTACGTTACCCACTTGGTCAGCGCCGTCCGGCATTACCACAGTCGAAGCCTGTACGGCGTTCAGCGTT
GGGAACTATTGGTGTCATAGCCCCTCGCGCTCAACAGTGGGCCTTGGTTTTATGACCCGTTGCAGTGTCCACTGCAACTTCTTCGACGGTGGCAGCAACT
CCCATTATTTATTCAGACGCTGATGCGTCCTGGTGACCACCATAGGCACCCCAGTTTCGGACAGAGGTGGAAAAGTGACTCAACAATACTCTGTCGGAAA
CCGCGGGCCGGCTAGATCCAAAGGCTTTGCCACGCCAGTCTATCCAGAGCTCGTGCTTTTCTAGCCACTGCATGCCCAGGATCAGATCGTACTTGTCCAT
TTCGAGGACAAGGAACTGTTCCGTGCTGTCAAAGTCCTCGAACTTTACAGCTAGGTCCATGTGGACCCGAGGTACTTGAGGTACTTCTACCACCGTACCG
TCGGTCAGTCTTACCGAGACCTGGTCCTTGCCTTTGATCTCACGCAGAGGGTCGGCAAACTTGTCGCTATTCTGAGCGACCGACTGGCGGCACGCGAAGT
TCTTCGACGCGCCTAAATCGATCAAGATTCGGAGGGGATGATCGTATCCCCGTACACTTGCGTATACACCACCAGTCCACCGCTGCTCTTTCTCGATTCG
AGAGCACCAAGTCTCTCTGGGGCTAAGCCTCTGAGATGTGCGCCGTCCGCACGTCCCGAAGACTTAGATCTTCCCCAGTAGGGCGCCCCGCCCCTACTGG
TGACCCCCGTTCCCCTGGCTCTTGGGTCGTGGCTTCTGCCATTGACCCTTTGAGCCCTTGGGTTTGGAAGAGTACTTCCTTTGCCTACCTGTAGGGCAGG
CACGTTAAGCTTTCCGCATCCGTAGCATCGGATGGAGCTTTGTTCGGCCGCACCCAGTTCCATGGGTAATGGGCCTGCACTGGCCCCGTTCGCGGGAGCC
CCTTGTGCTGCACCTGTCGGTGTGCTGTGGCCTTGCCACGCTGAAGCGGGAGTACGATCCTGTCGATGGATGTACTCCTCTTGGAGGGCGATTTGGATTG
CCTCCTCCATGGTACCAGCCTGCACGCGGAACAATTGCGTGCGGGCAGGGTTTACTCTCTCAAGCCATCCATGAACACTGTCACCTTGATGTGTTCGGGT
AGGGGATTCCCTACTAGAGATGCGGCTAGTACCCGCTTCTCCTGGATGTACTCATGCAGCTCACGCTTCCCTTGCTTACGGGTGAGGAAGCGCGAGTGCT
GGCGATACTCATAGTTCGCCGGCAAGAATGCGGCTCGAAGCTGTTCGCATAGCTGAGACCAGGTTGTAAAGCAACCCGGTGTCG