Description :
From Genome Similarity Track
Location :
Scaffold_1720:1- 1974
Sequence
1973 bases(100 bases per row)
CGTCCACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATGTCGGTGAT
TATCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACATCGTCGAAATCCACCCGGTCGGATTCATCCGACTAA
GACGGGTCTGCGGCCGATCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAAGCGATATTCGGCACCTGCCGTTTCCAGCTT
TACCGCATGTTCTCCTATCTTTTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACTCGATCCAAATAAAGC
CACACCTGCGATCCCACTTGGATTTGATGCGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATTCTGTATCGCACTCCGCAGCCGTTCGCTCACTTGGG
ATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTAGATCTCGGTTTCTCTTCTTGGTGCTACACACTGGAATGGCTGCTTCTAGGGT
GGATTTGGGATCCCACCCATGTACCAAGTAGAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTATTCATCGCGAAGGGGAGTCGTTCTGCATACTCA
TCCCAGTCCCTCTGATCCAAATCCTGGACATACATCTTGAGTGCCCTCGTGATTGTCTGCACCATGCGTTCGGCCGATCCGTTAGCTTGGGGACGATATG
CCATGGTTGCCCGCTGTCTCTGCCCCAAGATCCGGTTGAAAGCTCGAAAGAAATCAGACATAAAGCCAGGCTCCCGATCATGTCTAATCATCTCACTAGC
CCCAAATCTTCGGAAAACGCACTCCTCATACGATTCGGCAATGGTTTGCGCAGTTCTAGAGGCACTAACTTTGGCTATCACGTATCCGGTAAACAGATCC
ACCCAAATCAACAATTCGGTGTTTCCTTTGAACGACTTAGGCAACGAGGGGATATAATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCC
CAGGTGACTCCCCTTTGATTGTGGACCTACCCTTGCCTGTCTCACAATCCACACATTCACCGACATACCGTTGCACGCTCTTGAATAGTCCCCTCCAGTA
AAAACATCTTCAGATCCGTTGGTAGTTCCGACCAATTCCCAAATGTCCACCTTCTAAACTAGCGTGATAGTGATGTAGGGTGGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACGCTGATAG