Description :
From Genome Similarity Track
Location :
Scaffold_38:1- 1969
Sequence
1968 bases(100 bases per row)
TCCTTGACTAAGGAATACAAGGGATCATGAAGGTTTTTAGATATTGATGACCCACTACGCGCACTGAGTGATGCTTTCGTGTGTCCTCCATAACGGCTTC
ATCCAAAAGTGAAGAAGAGTTCAACTCTATGATGTCGTGTCGAATGACCACCACCTCTGAAAGGTCTCCATTCTTTAGTGAGTGATCATACTCATCGACC
GACAACTCTTCGAGTTCTAAAAGCGAACTTAACGAGGGTATAGCCTCAAGGCTAATCTTACCATCACAGGCACCAGTCACTCCGTTGACGAGTGTATACA
GCTGAAAGTCATCATCACTTTGTGACACAGCACACGATATGTGATTCTTAACTCTCTGATCGATACCATTCTCCACCTTAATTTGCTCCAAACCCAAACT
GAACGCCCTAATGGAATTCGATGACATGTCATTGGGACATGGGCATCGTCTTTACGTGGAATTACGTGCCACTTTCGCGTGCATCTGCTGAGCCGGGCTC
GGGATGCCTTGGTATTTCACCAAAACGTCAATATTGACATTCAGCGCGTAGCTATCACACTCAACGTCACTCAGTGGTTAGTTACGTGCCACGCCACGCC
ACGCTCATCTGATGGGTTCAACCCTCGATGATTTGACGCTTGGTCAACAAAGCTTTCAGCATTCAGTACGTTGACCTCACAACGACTATCACTTAGCCGA
GTACGTGCCGCTTCACTATCACATATCGAGCTTTGATCTATACTCATGTCTTTGACATCGTCAGGATCAACTAACTCTGACATTCCGATGTCCAGCACAC
TGACATTGTCAGCCAGTGGCTCGCGCCAAATAACGCTTCTGATTTCTATCAGAGGTGAGTTCATGACTCTCCAAGGCTCCTCTAGGGGCAGTGCGCGTGG
CGCCTAATGTTTCCGACCTCCAGTCGATCCATGGCTCATAGTGCTCAAGCCAAGCCATACCAAGAATGAGATCATATCTAGAGTCCAAATCAAGGACTAA
ACAGCGTTCGACACTATCAAAATCAACCAGGGTTTGTCAAAGCCCCTAACAGTCGCCTTTGCGACCAATAAGCCTGGCTTGTATTCACTCCCCGTGTTAG
AGTGCACGGGACTCCTTAAGGATAAATTCTGCTCGCCACTACCTCGTAGAGGCTCAACAGAACCTAGTTCTTCCACAGCAGGGCGCCCCGCGCCTACCAG
GAGTCTACGTTGTCCCGCACCGTACCAGACTTCTGGTAAGCGGCGGAAGTTCGGCTTGGAGTAGCCTGATGTGCCCTGATTATAGGACAATCAGATCATA
GATGCTTTGTGTTTCCGCACGGGAAACATCGTCGAATGTTTCAATGCTGTTCTACAGCTCGAAGCTCTGCTTCTTCGTCCGTCTCGGCGAGACTGAGGTC
CATAGGCTCTTGCCTATTGAATGAACTAAATGACTTTGCCGAGGTTGGGTTGTACCCATGGGTGCCAAAACGGGCTGCCTTAAAGTTGAGCTCAGCGTTC
AACACAATTTTCACAGCCGCCTCAAAGGAGATGGGCTAGACCCTTCGAGCCACGCCCGTACGAACACCCTCCATGAAGATGGTGACCAAAACCATTTCTG
GTAAGGGATCCAGCTTCATGACAGCGATTAGAGTTCTCATTTCCTGGACATATTCCCATAGTTCTTTCTTGCCCTGACGGTCATATAGGAAACGATAACG
CACCGGTAGGCGGAGCAAACATCCGGGATATTTCCTGTTTTAGCAAAATTTCATGTGGGGAAAGCTTCGTCTACCGACGTGCTACATGTGAGAGCCCATT
CTCTGGCTCTACCACCCAGTTTCGAGATAGCCATCCCAACTTGCTGTTGCTCCGACTGGATCATAGCAGATTATATAGCCATTTACACCTCCCTGATCCA
CAGGAGGAGATTCTTCCCTTCTTTTCCCTCAAATGTCCTTACAGTCTGGACAAGGGGCCGAGCTCTTG