Description :
From Genome Similarity Track
Location :
Scaffold_3013:1- 1967
Sequence
1966 bases(100 bases per row)
GCATACGACAGAGGACTTCTTCCGTACTTGTCTTTCTCGCTGACATCTGCTCCTTCTTCAATCAACAGCGCAACAGCCCCTGTGTGACCTTTTTCGGCAG
CATAGGACAGTGGGGGTATATGGAATTGTCTTTCTCATCCATACCAACTACCCTTCAATCAAGCCTCTGTGTGACCTTTGCAAGCAGTGTGCAATAAAGG
AATTCTGTCATAACTGTCTTCTTCGACGACGCATGTGCCTCTTTCAATCAATCTCGCGATGGTGTGCGCGTGGTCAGCTTCAGCAGCATACGACAAACAG
CTTCCTCCGTGACCATCCGTCTCGTCCATATTTCTGTTTAAACGCGCACTCAAGATCTCCCCGTGACCTCCTTTTGCAGCGAGCAACAATCTCATTTGTT
CGCCAGCGTTGCTATTCACAAAGGAAGAGCTGTCAGCCGTGAAGTGAGCCTGGCCTTCCTCCAAATCTCTCGAACACGCTCCTTCTGTGGCGCTTTGGTT
AGCGCGGTGACATCGCCTATCCCGATATTCCGGAAAATGAGTTGATGCTCATGTTGCTTTGTAACACTTTTTTTTGGCATTTCTTTCTACGATCTTCCCA
TAACACTTAGCGAGGTATACACATGAATTTTACCAGTTTTGCTGTTGTGTATAGTGGGATTTACCCACTCAACTGTATAGTGTTCAGTGCGACTACATAA
CGGAAGGCAAAAGGGTACATCTCGGCTTCTGAACCACTTGCCTTCAGTTTCTTTTTGATGGTGGGTGCAAGACGCGCTCATGCACATCAATAATGACGTC
CATCGCCATAAAGAGACTAGAAAAAAATGAAGCCATGGATGTAAACAGGGGCCACATAACGTTTTGTGTCTGTTGCGAGTCAGTCAACCAACGCGCCGAT
TTAAAGAACCGTGTGCTTATCGTACATTCGTGTGCATATTCAGCTTTGTATCCAGATACACAATTGACGCTCAAGCAAACAACAACCAGGTGGGTTGAAC
GCAATAATAGCGATATCGTGGTGTATGTATCGCGCTCTGTATGTTGTTTTTGCTCTGGGATGGTACAATACAAATCGTTGAGCCGGTCTCCTTTGACAGG
GTGATAAGTTCAGTCAGAGAACAAGTAAGGCGCCCCAGATTTCAGAAATCTGGTTATATATTGGAGCGAGCGATTGCGCATAGTCATGCCAAAGTATCGG
AATGATGAAGAGTGTAACGTCTTTAAATCACTCGTTTTAACAGGTCATTTCTATAAAAATGCCCCAGGCAACTTGATGAGAAGCATCAATGGATTCTGAA
AACAGAGGCATGGACGGATGGGCGAAGTGGGTTCAGGGATCTGGGATTCTAATTCTAGCCTTTAACATCTCATACGCACAGTGGACCATGCCCACTTGAC
TATAATTCATATATGAATACAACAACAAAAAATATACACGGCTCCGAGCCAGTCCGCGTCAAGAATCGAAAAGAAAACAGAAAGCATTTTCCACAAAGCC
ATGCTCAAAAAGCGCGCGTGCACACACAATACACTCACAAAACGCAGCTTCCATACACATACAGTATCCAAGCACTCACCTGCCCCTTATCCGGATATGC
ATTCTGCCTCTTTCCATCTAGATCTGGAAGGTGACGTTCTCCTCGCGCTTCCAAAATTTCGCTCTTGTAGTGTACATACCCGCAATACAAGTGTGGCTCC
GCTGCTCCGTCCGCTCTGTCCGCTCTTTCTTCCGCCCTTTGTGCTCCGCATACAAACTACCAGTCAAGTGCCGTCCCGCCGCGTCCACCAGAGAGCGCAT
GCCCATAATAAAATAGCTCTTCGCGGAGCGTTCTCGCAGCGTCGCAGATCGTAAATTACACCCGAAGACGCAGCTCCTACGATACGATACAATACGCGGC
CACCTCGCGACTATTACGTAGTGCGCTCGTTCCTGTGTCGAGAGGAGAACCCCGTCCGCGGCGCCG