Description :
From Genome Similarity Track
Location :
Scaffold_532:1- 19578
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_532-snap-gene-0.5Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_532-snap-gene-0.7Callose synthase
Pytul_var.sporangiiferummaker-pug3_contig_532-snap-gene-0.630S ribosomal protein S16
Pytul_var.sporangiiferumfgenesh-pug3_contig_532-abinit-gene-0.28Nucleolar protein

Sequence
19576 bases(100 bases per row)
AACCCGCGCCGCCGCTCACGCTCTCGTTTGGCACGACGAATACGAACGAGACGATGACAGCAGCAGCACCGTCGGCCGAGGACGCTGCGTCGAATGCGTC
GACAATCCTCGACCAGTGTCTGCAACTCCCGAAGCTCAACCTCGGCAGCTGCAGCATGCGCAGCGGGACCGGNNNNNNNNNNAACTCATCGAGCCGCTCA
AGTATCCGTTCACTACGGGCGCGCCCGCGTGGTGCGTCCAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAGCCGCGCGCTATCTCGCTGCTCGACGTCTACAAGAACCACGAATTCCTCACAACGGTATGTGCTTTTCTTTATATATATAGGTG
TCTTTCCCAGTGAACTATGAGGAGCTCATTTTGTATTATGGCTTTTGTTTTGTTTTGTTTTTGTAGCACACGGTGTACCAGAAAGGCATGTATTTAATCG
GCCGCAATGCCGCGATTTGCGATATCGTATTGAGCCACTGCTCGATCTCCAGGTGCGATTTCTTTTTTCCTTTCTATACACCGACCGCTTTGAATGACTA
CTTGCTGCTGTTATTGACGTATATGTATATTCAAATATGTGCTCTCCATTTCCCAATAGACTGCACGCCGGTATTATGCATCACGAGGACGGCACGAGTG
TGTACCTCGTGGACTTGGGCTCAGCCCACGGCACNNNNNNNNNNNNNNNNNNNNNNNTCTCGACGGCGCGCGCTTAAAACCGTGCCAACCGACGCTCATG
CTGCATGGCTCCCAGCTCAAGTACATCTTTACTCTTCTGTCTTGTGTTTATCTGCTGCATAATCCGTTCTTAACAACTGGTGTGTTTGCGAACTTTTTGT
GCAGGTTTGGCGCGTCGTCTCGGTCCTATACATACAAGTCGTTTGACTCGCGCGAGCAGATCGCGGCGATCGTGGATGCGCAAATCGGCCTCAACGCCGA
CGAACTGGAGCTAAACCGCAACACGCTGCTGAACCGCGCGGTGTCGTATCGTCTCGAACTTTCACCGAGCATACAGAACGGCGACGACGACCCGATGGCG
TACCCACAGCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCGTACCCGGAAGATCCGCAGGGCCACCAGCGTCGCAGCAGCACGGACG
ACCTGACGCTCTCGCTCGCGGCGTTCCGTCACGACGAGCAACCCGCCCGAAAGCGCTCGCGCGGCCAGTCGGGCACATCGCAGGGCTCGTCGGACAACTC
GATGGGCNNNNNNNNNNCGTTCAAGACGTCGAGGAGGAGGAGGAAGAGATGATGTTGGCGCCCGCAGCAGTCCCCAAGCGCGTGCATTTCACGCCGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCCAGATCACCTCGGACGCGCACTAAAGCGCTCTGCGGTT
GATGGTGGGCTTTTCGATGTGTATGTGGGTGGAACTGTGTGTGTGGTGCGTATGAAGATGGCTTGTGTATAAGAAGAAAAGGAAGACAGCGAAGCAAAGA
GCAGACGCAGACGAGCAATGCGCCTTGTACGAATAGGAAGAAGACAGCGAGAGAAGCAGAGAGGAGAGATGGAGAAAACGACGGAGATACACACCGAATG
AGAGAAACGAAAGAGAGGAGGAGGAGGAAGAAGCATGGTTAGGAATAGCAGACGCAAGTAGTAATTTAAAAAATGGCGCACGACGCAAAAGCACGCTTGG
AAAGGAGCAACGACAGCATTTGTGTGAGTTCATAGCGCAAGTGAGACCATGGCACTGAATCTGGTCCCTTCGCGTTCTCAGCATCATCGCTTGTCTTCAT
GCAACCAACGAGACAAAAACATGGGGGGAAATATATCAATGTTCGTTTATCCAGAGCAAAATGAAAAAGAGCGCAACTAACTATACAGCAGCAGCAGCGA
GTCTGCCACAGATCTAGTTTTTTTTATTCGTTGTTGTTGTTCTTGAACTAAAGAGCTTTTCGCCCTTTTCTTTGAGGGGTACACACGCGAAAATGGTTGA
CATTTACGGTAGTCCGCCTGCTGGAGACTCGTATACTTGGTAGTTCGAGTGCGACTTGCCGCGCGAGCGGCTGAGGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCGAGCGCTGCGGCGCGATTGGCGCATGCGGCGGATGCGCGCGCGCTCGACCTCCATCTNNNN
NNNNNNCGGTCTTCGTGCACAGCATGCCGTTTTTCTGCGTGCCGACGCCAAAGAGCAGCAGTAGCACGATGAAGCACGCCCCAGAAAGCCCGTACAGGTA
AATGTACTGCTTGTTCGCGTACGACGTGTTCACGCGCATGAACAGCGACAGCACTGGGATCAAGAAGAAGAGCATAAAGAACAGGTTCGTATAGAACGCA
CGCGCCTTGGTGCGGAAAAAGCCCACGCACGACAGCCACAGCACCGATGTGATACCCAGGCCCGCGAAGAAGTACAGCAGCAGCCCCACAATGCGCAGCA
TCAGGTACTCGGAGTCGCCCGTCCAGACATTAGAGCTNNNNNNNNNNNNNNNNNNACACCGAGGATCGCGACAAGCGCGGCGATCGGCAGCAACGTGCAG
AACAGGATCCGTCGGTGATCCACGCGGTCCATGAAGAAGAACGAGAACAACGCGCCGAGGAACTGCAGCGCGACGCAGTTCACAAACATGTACTGCGCAT
TCTCGATCGTGCTAAACTTTTGCGACATGTACATGTTCAATGCACCCAGGAAGAGACCCGACACAAGCATCAAAAAGATGCTCAGCACAAACTTGAACAA
AGTACCAGCACTATCCGCCGAATCTCGCGAGTCACCAGCGGCTTCTTCTTCGCGAATCATCTTGAGCTCTTCCGACACGCCTTCCTTGCGACGCAGCACA
GCTAAGCAACGCTCACACGCTTCGAGACCTTCGCGCAAGTATACCCAGTACGGACTCTCTGGGAAAATGTACACGGCCGGGGTCATGATCGNNNNNNNNN
NNNNNNNNNNNNATCACCGTCGCCACAAACACCTGCCAGACCCAGCCGACCGAGTTGGCCGACGACGAGAACCACGCGCACGCGAGGACACCCAGGATAA
ACCCAAGACCAAGCAGCAACAGCGCCTTGCCGCGCATCTCACGCGTCGCAATTTCGTAAATGTACATGGCGAGTGTTGGCAGCAAAATACCAACCGCACA
GCCGAGAAGAGCCACACCAGGGAACAGGAAACTTTCTCCAGACGCCTGTACGGCACTCACCGAGACCATACCGAGCATCGCAAGCACGCCACCGCAGACA
ATCGAGAGGCGTCGACCGATGAACAAGTTTGTAAAGCCAGCGACGAGCGAACCACCGACACAAGCAAATAGGAAAATGTACGTCGTAGTACCATTGCCAG
CCTTGCCATCCAAGAGTGCGTACGTCGTCACGTAGCTGATAAAGCCAGGTGTCGACTCAAGAGTCGCGAACAAGTGGAAGATCCAGCCGCAGCCACAGCC
ACCGAGCATGCCCATGAACGCAGCAAGCGAGAATGCGTACTGCGACGACGCCGACACGACCTCCGAGAAACCCTTGTTGTACATCATACGCGTCTGGATA
ATGTTCAAGAACGGGATGCCCGACATGATAAACAACGGGATAATCATCGCCGTGCAAAACACAAAGTCGAACAGGAACGCGAGTTGCTGGAACATGGCAA
CATTCGCGATCGACGAGTTCTTAAAGCTCCACATGCGGATCATCTCGTTCAAGCCGTACAGACCGCCCATGTAGCCAAAGAAAATCGCCAGCGCCGAGCT
AATGCTGGCATCCATGACGACGCGCGCAATGACGAAGTATCCAACCAAACACGCGACGATCGTCGCCAAGTACAAGCTGGCACGCACAGGTGCAGGGCTG
CCGCGCAGCGTGCCTCCTGCAGCTCCAAGGACGCCAAGCAGAATCACCGTCGCGACAACGGCACCGAGCACAAGCGCGACCGCAGTCGCGTTCCAACGCA
ACGTGATCACGTACCACATCAGCAAAAAGTGACGACTCTCACGCAAAATGACCGTGAAGCGAGCAATTGGGCGCGTGTTGTGGAACAAGCTGAGCTCGCT
CTTCCACCAGCTGATCCAGCCACCACACATAGGCTTGTCTTCGTCCACAAACGATTCGTCAGCATACATCCACACGGTCCACGCCTTGATATCGGCCTTC
GTCTTTTCCCAATCGAGACCATCCGTGTTGAAAATGTACGGCGACATGAGCCAGAGCACGGAAATCGTCCAAATCGCAAAGGTTTGCACGCCAAAGCCCT
GCGCAGTCTCACAGAAATCGCTCGACAGGCTCTCTGTAACTGGACCATCGCGGCGACAGATGTTGAACTCACCGAAGGTCACGTACACCAAGCAAAGACC
CACGAGTTCAAATGCCTTCCGGTAGTGACTGTTTGCGTAAGCCTTGTACAATAACACAAACGTTTCTCGTGTGATCTTAAAGCCACGACCCGTCGCCTTG
TACTGCGCTTCGCCGTGCAGCAAGTTGTTGTCAAAGTAGTGCATCGTCGTTCCGACCTGGAAAATAAAAAACGCAGGGCCACCAGTCACGACCATTTCGA
TAAACTGCACAAACCCGCGTCGAAGACCCATTTCACCAAAGTACACAGCGATCAGCGGTAATGACAAAAACAGACCAGCCTGGATATAATACTGCGTATT
GATCACCGAGTCTGCGTCATCGTACGCACGATCGACAAAGTTCAGGTCTTCGTTCAAGTTGATGATATCTTGCGATTCCATCTTGAAAATCACTTGCTTT
TGCACGCCCGCGAGCGCCATGTACACCTTGCTGTACATGTACACAAACGTCGTCACAATTGTCATCCACGTCGCGAAGTAGAAACCGGTGTGCGAGTAGT
ACATCGAATTCAGACGGAAGAAATCCATAAATTGGCCCATACGATGCGCTTCACGAGCGAGCGACGTTTCGCCTGCACCGTTCGCCAACTTGCCTTCAAA
CATCGAAATCTGCGACAGCGCCACATCACGACCTTTACCGCATTGCATAAACTCCACGTGCGTGACCACACCGCCACGAAGCGTCGAGTTAAAACCAGCA
AACACATCTTCCGACAAGTTGATACCCTTACTCGCCTTCGACAAACCACCACGGGTCAGCGCAATCACCTTATCGAAAACATCTGGGTGACCGTAGTGCA
TACGCACGTACAGCGGTTCCGCCAACACACGCTGCGAAAGCGTCACAAACACCAATTCTTGCCACGTCTTGAACTTTGCCAACGACGATGCGTTACCCGT
GAAAATGTGCTCACGCATACCAATAATCGAGACCGGTTTCTTCGACGGGTGGAGATCCGCCGTGCGAAGCATCTGCGGCATCTTCAGACATTCTTCAAAG
TAGTGCTGCTGGTTCATATCAATCGTCTGCACAAACTCACCGCGAGTAAATTGCACCCCATTGTTCTGGTTTTCTGGCTTGCCTTCACCCAAAATCGGGT
CGCCAGGCAACTGGTACCGGTAGACTTCACAAATTTCACCATTTTCGCTTTTGATGAGCACCGTATCATACATTTTCTCTCCGTTCTCCATGTCAATCGT
GTCAACGTACGCAACACGCAAGTTCGGGTATTCTTGCAGTAAGTAATCGATGTCATCAGCTTGCTGCTTGTTCTCGCGGCGGTGCTTGCCATACACTTGA
CACGCACAAATGTACGAGAACTTGAGACGCACCATGTCTTGCAGTTGCGTCTGCTTCTGTTCCGCGGTTTTACCAGGACTTGAGCCGATTTCCAACCAGT
GCAAAATCTTGATCGCATCTTCGTACATCATCATACCTTGCACCGTACGCGCAAGCGTCTGACCACGGTACGAGGCCCAAAGACGGATATCGAGTGGGAA
TTGCTTCTGCGCTTCTTCTGGCGAGCTCACATCCATACGTTCCAAGAAGTTCAACCACTCTTCTTCGTGAATCTTGGTCAGGTACTTCAAAATCGTCAAG
TTCTTGCCATCTTCTTCGGCCTTTTCGAAAATCGGGTGATTTACGAGCGGGTTGTTGAGATCCTCGAGCGAAAACAGCACCGTCTCCGCGTAAAATGGCG
TCACGACCGAGAACGAGCGCATCTCCTTGATCGCTTGCAATTGAGGAATATCCATGACAAGCGACTTCATGAAAAAGCCCAAACGACGCTGCGCTTCGGT
ACAGCGCGGCATCGCCTCCGAGCGTTCCAAAGACAACAACAGACACGCACGCGTCGCCGCACCCATGGCACTATCGCTGCAAAACAAGTTCACAAGACCG
CGCGACGCGTACATGTACCCGTTCGTGCTCGAGCAGAACTTCGAGTTTCTGAACTTGCTTTGCAGCACCGGGTCGACGCAGAACGCTTGCAGGATGTTCA
AAAACACTTCCATCTTGCTCACAAAGTTGCGGACAACACCCATCGTGTGCACACGGGCACCTGGCATGTGCTGCGACTGCACATCAGGGTCTGGCAATTC
CAAGATTTCTTCCAAAAGATCAACGACAGCGGCACGAAGACGCACGAGCTCACGCACATTGAACGACTTCATGAATCCACCGGCCGACGCAATGTCTTCG
ATCATACGGAAACCATCCATGACATCGGCATCATCGTTGCCAAAAAGCGACGTCAACACGTAGAAACTCGCCGTGTAGAAACTGCGAAGCGCAGAAAGGC
AATCGCTTTCCACCAACGCGACGCGCAATTGCGACTCGCCCTTGCCTTCCTTTGCAGTCTTGATCGTCAGGCTCATGGCTTCGCCGAGTTTACCCGCCGA
CAAAAAAACCGGCTCGAACACTTCGCCGTTGCTACGGATGTCGTATTGTAGAATCGCGGCTTCCTTGTCGTCCAGCAAATCGCCTTCGCGGAACGAGTTC
ACAATTTCATTCCACACAACAACGAAACGAAGCATCATCTGCGACTCGTACGCCGCTGCCAACGCACTTGGACGCGACGAATCGTTTCCGTTCGCCGACG
CGTCGCTCGCACGCGCCATGATCGTCACAACCTTCTGGTCAAAAAGTTGTGGCGCGACACGGAACGCCTTGGACATTTCCTTGACGCCGCGAATTTCACC
CGTTTTCATGAGCACACCCTTGAACGCACCCAGCAACGCCTGGAAGATCGTAAAGTAGATCTGCGTATCATAGTTGAAAATGAACACCACTGGCAACCAG
AGCGACAAGATGACGCCCAAGTTGTGGAACGACACTAACGAACTCTGGTAGTCAAGCTTCATCGTGTAAATCGCGAGCGATGGCAGCATCAGCGGGCGGA
TCAGGATAAAGTACGACACAATAGCCTTCAGCGCCCACAACGCCAGCCAAAAGATAATGTACTTGATCTGGTATGAAAGTGGTGGCGTCATGTTTTGTCC
AACGTAGCAGGACTCGCCTTCACGCACAAACTTGGACGCAAACGTACCAGAAATCAGCTGCGGCGAAAACGCTTGGACCAGGAGCACGAGCAGACCAGGA
AGGATGAAAGCGCCGGCCACAGGAAGGAACTGGTCCAACAACGCCGTGTCGCGCCCTTCGTTCAATGGCACGAAAATCATAAGTCCAAAGAGCACCGCGA
AGCCACCGTTCCAGAGCATTCGAACCACGAGCGCCGAACCATAAGTGAGCGATCGCGACGACGACGCCGACGATTCNNNNNNNNNNNNNNNNNNNNNNNN
NNNCAACAAATGCCAGCCATGGCATGCTTCCAGCACACACTTGAACAAACAGAGACAAGCATGGGAAAACACGATCGCCACGACTGCGAGCTTCAGGTCG
CGCGTGTGGTACGGCTCCACAACGTCGCCGATGCGGCCGAACTGCGTAAACCAGTCCTTGCCACCATCGGGCGAGATCGTGACCGCAAAGGCCAGCACGA
CGAGCAGGACCAGGAACATGAGGTTGAACTGGAAAATACGGTAGTAGTTGAGCACGAGTGTGAAGATACTACGGTGCTCGTAGAACGTCTTGCCGTGGTT
CTGCGACAACTCGCGTCCGACATTCGTGATGTCGATGCTCAGACAGTGCTGCTTCCAAAAGTACTCGTTGATATCGTCGTAGTTGCGGATCTGCACATGT
TCTAACGGCTTCTTCAGCTGGTTGCGGCGCTGCATGTTGCTGCATTCACTCCAGATCGGGCGGACGACGTTCGCCAGGTACCAGCCCTCAGGCTTGGTGT
CTTGGACATTAGTGTCGGCGTTGGTCGNNNNNNNNNNNNNNNCATCATCTGGTGGTACAGGTAGCAGAGGCACTCGGGCATGTGCCGCAGGTTTCCAGCT
TCACCCCAGATCAGGAAATACAGCATCATGTCCATGTGCAGCGGATGCTTGAGTTTGCCGCCCGCAGACGCACGAAAGTGCACGGGCTGCGCTTTCAAGA
ACTTGCACCAGTCACGGTAGTTCCCAAATAGTTTCTTGTGGAGCTCGATAATATGGTGGTCGGGCACATCGGACGGCTTGGAGCGGGCCTTGCCGTTCGC
AAGCAGCAGCAGCACATGCTCGCGCTGGTTCGACACCGAGCCTTCCTGGAAACCAAACTTGCTGCGCAAGAGCTCACAGCAAAAGTCGATAGACGCTTCC
TCGTCGTCGGCCGCGTACGCGTCGCTGTCCTTGCCGTAGCTCTTGCCGTTGCTNNNNNNNNNNNNNNTGCGATCCGTTCACATCAAGCCCCGTGAGCCGT
GTGCTGAAGCGCTCCGTGCGGCCCGAGTTGTTGCGCCGCCGATCGGCATCGAGCTCAAAGTAGTTGGAGCTCGCACGCCGACGGTATTNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGCAATGTTTTCTCTCTCTTTATTCTTTTCTCTGA
AAAGCTAACGCTTCTTTACGCGCACAGGCAGTTACGACACACCCGCCGCAACGACAAACGAACGTGCGCCCGTCAACCTACGCACACACGCACACACACG
TATGTCCACGCGCGGCTCGTCGAATGCGTCGTTAGTTAGCGCTCCTCTAAAAGCCCGCTTCTCCGTCGCCCCAGCACGCAGTCGGGAAGGGGAAATGGGA
TGGAAACTGATCGCTTTCTTTGCTTTCCTCCTCGTCTTTCCTTGCGCGCCCTGGCTCGAGGGGGCGCTCGTTGCAAGATAGGGGGGGAAACGAGGGTAGG
GGAGCGCGAGGGAGAGACAGGAGATGCACTAGGATGAATATTCAGCCTTTGGATAACCCCTAGTCCCTGCTCGCTGATTTTCAGCCAATCAAACTTTTAG
AAAATATTGTCCCACCAACAACATACATGCATAATGCCATTCATGCATAATGCGCAAGAGAGAACCAAGCAGCCATCTTTCGTGGAGGGGAACAGAATCC
TGTATTTTTTTCTGATTTTCTTCTTTCTGCACTTCGACACCAAAATGAGTTCTACTACTGTGTGTGGTATATCTATGCATGTGTATGGAATTTCCACTGT
TAATGCAACCACGCGACTCCTCTCGAACTGTCCTTGTGTACTGAGCAACAGCGCTCTTTTTGAAAAGCCGCCGCTGCAAACTATAGTCTCGTACAAAGTC
CAACAGCTCAATGACGACGAGACAGCTGGGAGACAATATTTTCCTACGCCAGCGAAAAAACAGCTACCCCCCTCAAGTGGCAACCGCAAAAAAAACCAGT
TTCGCTCTCTTGCGCACAAACGGCGCGGCGTCCTCCCTCGCTTTAACGGCTAACGACGTTGCGTAAAGCATGTCGTAGCCACACTAAATACTCAAAACTA
GTGCTTCCAGCAAGAGTTGCAATAAATGCGACGGAGTTCTTCAAGCGAGGGGACTTCTGTGAACGTCGACATCGATTTGCGTTTTGTTTGTGTGAAGACG
AAAAACTGAAGAAGCCCCTTCGCGGGTGTCTTCTTCATTTGCAGAGTGGTGGGCGACTATTATTCTAATAACTCACCTGTAGACCTAAGATTCGCGTATG
TATATATATTTAGTATCCTATATATTTGCAAGTACGAGGCTAAATGGCTGCACAGTATGGAGCATAGCCACCAAAAAAAGGAGTCGTCTGAGAACATCCG
TTTTCATTTTTTTCTCATGATGGCTCGCTGGATTTCCTTCACAATAATACCAAGAGACAGCGCTGCAAATGCCATGTGTGCATGTGGCCCATGTGGCTGG
GTTTTGGATCTGCGTTCTTCTTGGTTAGTCGACTCAGTGGCTGCTCGGCTGTTCGCACTCGAAGCACCAGGCGTGCGGTTTAAAGTGTGCGAATTCGTTA
AAGACATATTTTTGCGTGACGAATAGAGCGGATGTGGCACGAAGGTACAAGCGATTACAATCACAATGACATGGTTGTAGCATCGAGGTGACTAAACCAG
AGCAAAAAAGGCGGCACTTTGTATCAGCTACATACATGACCGACACACGCAGAAACGAGTGCTTTCGATATCGTCGCAGTGGATCATGGCGTGCTATTAG
AAGAGACCGCTGTATCATTGCATATCCTCTCCCGTAAGGAGCGCTGCGAATGCTTACAATAGTACGCATGTGCCACTTTGTGCATTGTCCTGCATATCGT
CCTACTTAGGACAAGCTTCTCCTAAGCGTACTTCCCAAAATCACTAAAACCACTATGATTGGCTAAAATAGTGTGGGGCGATCCACATTGCATCCGTACC
AAAACACGGTAACCTTCACCCTGTCCTTGTGCCACTTGAAGGTACATGCGATTTAGTGGTGGAGACTTGGGCTCTTTTCCTGTGCGCCAACGACCCACTC
AGCGCCTCAAGCAAGGGGAAGAAGCACCACGCCAAGCAGGAAAAGACGAGATGGTGGTGAGACTGCGACTCGCGCGCTGGGGCCGCAAGGACCTCCCATT
CTACCGCATCGTGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCGCCACGTGACGGCAAGCACCTCGAAATCGTACGTCCAGCTTGTCCTTCTCTG
TGTCGAATTGGTGCTTAAAGCCGTGGAACGAACGCATGACTCATCTTGTTCTCTCTCTGTTGATGGTGGTATAATAGTTGGGCACGTTCAACCCGATCGC
CGCGGCCGATGGCGTGAAGGAGCTGCGCGTGAACAACGAGCGCGTGCGATATTGGATCTCGGTCGGCGCGCAGCCGTCGGACCGCGTGAGCCACCTGCTG
GGCATTGCCAACATCCTGCCGATGCCACCCACGCGCCAGTACGGCATCAAGAGCATCCCAAAGAAGGACCGCGCGCCTGCCAAGAAGTAAGCGCAAGAGA
CTACGAAGGGAGCCATGTACCAGACGAAGCGATGCAGGCGATAGGCACGCGCGCAGGATAGAGCAGAGCACGGAGCCCTAACAGACAGACAGAAGCAACA
ACGAAGCAATTGCGCGACGACGAGCGCAGTGACTAACTGCATCAAGCATATGCACAAAAGCAATAAATAAAAACAAACAAAACACTGATGACCATAATGC
GAAAACTTAGTGGTGTATATAATAAAACCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGGAGCTCTCGCACAGTTCATGCACAG
CGTACTCAGAAGCAAACAAAAAAGCAAATCTAATTATCCAGTTTATCGTTTTTTTGGGGCGCCATCGCTTTCTATTTCTTACTAATGCGTCGCTTCTTGG
CCGGGCCTGAGCCGCCGCCCTTGAGCATGTTGCCGCCCTTCTTGACCTGCTCGTTGAACGTCGCGTTCTGCTCCTCGAGCCATCGCCAGATCTCCTTCTG
CTTCTCGCGCTTGCTCTCCAGACGCGCGTTCTCCTCCTGCTGCTTCTCACGCGCCAGGAACTCGGCATCGCGGCGCAATTCGCGCGCAGCACCCTTGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTGGCCTTGTCACGGTCCGCGCCCTTGTCCTTCCG
CAGCGTGTAGTTCTCGTCGAACTTTGGCGTGAACGTCGGCAGCAACGCCGGCGCGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTCGTCTCGTTCACCCGAGTGCTCTTGCCGTCAAACAGCGAGCGCGTGAGCTCGTGGAGAAGCAAGTAGATCGGGTG
GAAGAGCTCGTCGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCGACGACGCCGCCGCGAGCTCCAGCTTGGGGAGCGTC
AGGTCCTCGTCCTTGTTGGCGGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCGTTCGCAGCGAC
GACGACTCCACCAAGTATACGCGCACGAGCTTCTTGAGGCACACGAGCACTTCGGGCGTGAAGCGCTGCTTGTCCTTGGTGATCTGCAGCATCAGCGTGC
ACGTGAAGAGCGCTCTCGTGGCATCCTGTCGACTCTCGAGCGCACCGTTCACGAGGCTCTCACCCAGCAGCGTCTCCATGGGAGAGATCACATTGTGGCG
CAGATCCGACGTCGGGAAGATCTGGATCAGCGCCTTGAAGAGCAGCAACTCGGACAATTCCGGCCACTTGGACGGCGACTTGGTGCTGTGCAGACGNNNN
NNNNNNNNNNNNNNNNNTTGAAGAGGTTGATCAGCAGTTCGCGCACGATCACGCCCGCCGTGTCGCTCAACTGCTGCGCGAGCGCAAACAAATGCTTGGC
TAACCCGTCAAGCTGCAAGCACACAACGCAAAAGCACATTGTTAGATACATGCAACGTCCCCACATATACGCCACATAGACAAACAGACGACTTACATCT
TCGCGGTGGACCGCGTACTTGCTCGCGTACTTGAGGAACTGTCGGATCAAAATCGCAAAGAAGCTCTTCATCTTGGACTGATTTTCGACGCTCAGACGCG
GCGAGTAGTACGTAATGATGCGCTCGACGATCAGCGTGCGGTTCGCGGCTGACTGCTTGGCGTGGTTCTTGAACAGCGCCGTGAGCTCCTCGGGACTCTC
TGGGCACGGGAACACGAACGGCAGCTCCTCGGCGGCTTCCTGGCGCTTTCGCTCCTTCTCTTCGTCGTCTTCATCTTCATCTTCGTCAGCGTCTTCTTCC
TCTGCGTCATCGTCTTGCTCCGCCTCCGCCGTGGCTTCTTCTTCATCACTGTCATCATCGTTAGACTCCGCTTCCGAATCCTCTTCCTCCTCTTCTTCCT
CTCCATCCTCTTCCTCATCTTCGTCCATTCCTTCGCCCTCCTCATCCTCGCCATCCTGCTCAGCGGCATTGAAACGCGAGTCCAGGTCATAGTCCGCGGA
CAGATCGTCGTCCGTTGGCGGCATCACGATCTGCTGCGGCGTCTTCTGCTTCTTCTTGCCGTCTTTGCCCTTCTTCCCCTTCTTCCCCTTCTTTCCAGTG
GTCTCGTCGTCACTGTCGTCATCGTCATCGCCCTTCATGCGCGCCACACGCTTCTTCTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATCGC
GCTCCTTGGCCGCGGCTTCCTCGGGGGACATGCGGCGCTCCGTGGCCTTGGCCTTGGCTTCGAACGCAAACTCGCGCGTGAGCTTGTCGAACTCGTCCAT
CGGCGTCTTTTCCTGGATCTCCTTGCCATTCGATCGCGTCGGGCGGAACTCGAGCAGCGCGCGGATGTCGTTGAAGCCCTCATCCAAATTGTCCGTCGCG
TCTTCCTGTGCCGACTTGTTCTTCTGGCGCTCGGCCTTGAACATCTTGGCCTTGAGCATCACCTCCTGCATGATCTCCTTGTGCGACTTCTTGCGACCAT
CTTCCTCAGGAGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTCGTCATCCTCGGCGTCCTGCTCGAACGCGGCGTCGGCGTTCAGGTTGTCGTAATCGTCGATCTTGGCGCCACCGTGCG
TCAAAAAGAGCTCGTCGTCATCCTCATCATCCGAGTCGTGAAGAGCGAACGCACTGGCGTTGCGCAGCTTGCGCTTGCGCTCGGTCTGGAAACGCGCGAT
CATCTTGTCTTCGAGCGACATCGTCGGGTCCTGCTCACCGAGACGGCGGTCCTTGAACGAGTTGGCCTTGTTGCGCGCCTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGGCCCTGACCCTTGA
TGCGCTTGCCGATCACCTCGTACTTGGCCTTGGCGTTACCGCGCACATCGAATGGATTGCGGCCCGTCGACGACGACGTGCGCACCACTTTGGCGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCGCCACGAGCGCCACCACCAG
CGCCACGATCGCCGCCGCTGACCTTAAAGTTCCCGCCCTTCTTCTTAAACACCATCGTGCGCGAATGAATGCAGCAGCAGCTTCAAGCGCCAAGTGTGCC
AATGCACCAAGTGGCTGGTGGTTATTGCTGTCGCTCTTCCCAGCGCCAATCAAACAACAAGGGGCTGTATACAACGTTTCATGACACCAGGGTGGTGGGT
GATGGGTGGCTTTGTTTACTTACCGATTTATGGGTGGGTCGAAATCAAAACGCGATATTTGGGTGAATGGGTATTGGTGGATTTGACCAACACCGAACTT
AAGAGGGCCTCATTTTAAGGAACAAAAAGTTGCAGTCGAAGTCCCTCTATTTAATGACATGTACCCTAGTCCTAAACGGCCAAATTAACCCTTTTGCAAT
CTTCACATGATAGATAGTAACTTAGCACAAAGTAGTCAAAAAATTACATCATAAGTCTACCCATACGCGTCTACTTATACCTTTCGTCGACTTTCAAGCG
GTACAGTGGGCAGTCCCAGTACCGTGCCCATCCCTATACAGTCGCCCCGCGCATGTTCTTATCTCCAGGTGCGCGTCAAAAATTACGCGGCGGTGGCTGC
TGTGGAAAGCTCCAAACTAAAAGGAAAGCAGGTCATCAGAACGCAGCCACGCGCGCGCCCAGATTCACTCCACCATTCCGCCATATACACGCACCTAATC
CTTCCTTCCTATACACCAGCACTGACACACGCCATGGCCCACGCGCAGCAGCATTCAGTCTCGATGCACGCGCCGCTGGACGACGACGACCTGCGCTTGT
CCCTGGCGCTGGACGCGCTCGATGACGATGACTCGACTGGCGCGCACGACGTGGACATGGACATGGACGGCTTGGAAGGCGTCATGGGCGATGCCCATTG
CAGAGACGCGGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGACGCGTTCTACAGCTACTCGACGTGCTTCCAGTCGGCGTCGTCGGAGCTCGTGGAAAAAGATCTCGCCGGCG
GGTTTGTCNNNNNNNNNNTGAGCAGATGCTGCTGAACGAGTCGGAGGAGTTTATGACGTCCCAGTTCACGGCAGGCGTGAGTGCGGGTGGCTTGGATGGC
GCAGTAGCGAGTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNGCACGATGCTCCGCGCAGAGATCACGGCGCACCATTTCCGGCATAAGAGCAATAGCGCAATGAGTAGCAGCAACTG
TGCTAGTACAGCTAACAATGCGCAATTGGTGCTGCTGAAGCAAGCGATTGCGAGCTCTGCGGTGCCGTCGTCGTCTATATTCAACATGCCACCGAGATAC
TTTGACACTGCACAGAGCTCCCCACAGAAGCGGCGTGCGTACCGACGAACGTTTGGCGAGCGAGCGCAGCCATTCGGCTTTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCGAATTACCAACCGCCATCATTGAGTATGAAGCACGATCCGCTGGCGGCCCAGCACATGAATCAGCATCACCATCATGCTG
CTAGCACTGTGCATGGCGAAGAAAACCGTCCGCCACCAGTACCAACTGCAGACAAAGTCGACGAGAACGACGGCGACGATGAGATGGTACACATTAAAGA
AGAAATTGTGGATAACACGCGTTTTGTAGCCGCTCGCAGTCTCGTTCCAGTGACAGCAGATGAATCCATGGACGACGAAGAGAAGCAACAGTGTGTGGTG
ATGAAGCAGGAGAGAGTGCAGCAGCTGTCTTTCACTGGCTTCCGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACGCCGACGAGCATTT
TCGCCGTGCCACGACGCCGACTCCTTACATGCCAACTATGGACGACGAGGCCACACTCCGAACCCCATTGCGCCGAAGCGTGTCGACGCCGATGCCGGAA
GTGTTGTCTGCTTCTTCGAGCTATTACCAGCACCAGACCCCGTCGCAACAGCACGCTGCGCATGGACTCACCAGTCGGTCCATGTCGCCGGCCGACGCCT
TTGAGAAGGTCGCCGTTGTTGTGCAAGTCGCCAAAGACTCACCCGCCCGTATGAACAAGTTTGAGTGGAAGATCGGTGGCTCAGCGCGACCAGACGCGCT
CAAACGACAATCGCAACAGCAGCAGCAACAGCGAAAGATGACGACGCTCTTAGCTGCGGAACTCGGGAAATTGGATGGAGACATCTGTGCACCAGCAGCA
GCAGCCGAAGGGGCTGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCACGAGTTCTCCCGAGA
AGCGCCGCGTGCACTCGACGACGTTTGGTTCGTTTGCGCGCTCGTTCTCGTTCACGGGCAATGCGCCACAGTCGTGAGTTTTGTAAAGTAGGCAGGTAGG
TAGTTTTTATATGTGTGTGCGCGTGCTGCTATGGCTGTGGCGATGCACTATCAATCGATGCGAGAGAAGCGGGCGGTAATGCACCACCAAAGCGTGCATA
CACAGCAGCAGCAAGTGCATTTTGACCCAAGAAGCAAAAGAGACAAACAAATCTGCAGAGAGTGAGTTCGCTGACGAAAGACACAATGGAAACAAGCAAA
AGAAAAGCCCGGATGTGAACAATGAAGACACAAGATACAAACAAAATTCTGCATCCGGTATGGAAGCGTGCGACCAATATCGTGTGGTGGTGAGCGAATC
CATTAGCCTATCGTAGATGCTGACGCCCATGAATACATGATGTGGACTCCACCGTCACTGTCAAGAATCGTTGGATGCCCACAATGCCTCGTAGCATTTT
GCGCTTGAAAGAAAAAATAGACACTTTTTGAATGCGGCTTTTCGCACATAATCGCTGATTTTGTCCTTTGTGAAAGGCTTACGAGCGGTGCTTTCTGCTC
TGCCGAGCATGAAGGATACGCTGCACGAAGCCCCCACGGTGCTTGGCACGGCCGCAGTGATCCTTCGACCACTGCGCTTTCTGTAAGTCCTCCTGCTTGC
ATAAGCTTTAAGATGCCATTGACCTGCTCACTTGTGAAATCCACTGCAGATTTGACGTGGAGACAGAGATTGCCGTCCTGGTACCGATCGATCCGCGCCC
TCCACGTGACAATCCCGATAGGCAGAGCGATGAGCTACTGGGCCAAGTGCACGTCCACATCATGCTTTCCACGCGTCCGCCGTTGATCGAGCGCCAGCAG
CTCAGCGGATTCCTTCGAGCCGAGCGACCGAGTCGTGCGACCAACGAACTGGACAACAACAATACTGCAATCGACTTGGGGATACGGGCCACGCCTTATT
GCGGTGCCGAGAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACATGGAGGAGTTGAGTGGCCTGAAAGGCAGGTTCATATGGCTTCTCGTG
CGCATGCAAGTGCAGCAGAAAATGCTGCACCAGCGGCTCTGGAATGCATGCGTGCAGTACCAAGTCACGCCTGCCACGGAGAGCTACCTGCTACCAATCG
AGCACACAAACGTACGTCTCGCATCAATGCTTTAAATCCGCAAGACGATCTCTGCTGATCTTCATATTTGTTGCGTCGTGCTTCAAACATCGCACTAGGT
CGTCAAGGTGCTGGTGACGGATGAGCTCCTCGTACAGGTCGACACCAAGACATTGCAGTTCAATTTCCTCTCGCCAATGCCGCAATCACCTCTTCCTGCC
GCCATCTCACCCAGGTAAGCAAAGCCATGACCACAGCTTCAATGCCATTGCCAGAGTCGACTTAACCTCATTCAACTTAGAGACCGCGTGCACGAGGTAC
CGGACGAGAAAATCTCGAAATCGCGGCAGGATGATGCAAAACACCTCGAAGAGCTGGAGCGTGCTCGGACACTAGTAGAGGCAAATGAAACCAAAGCCTC
TGCGGCATTGACATCGGCCCAGGCGGCTGCCGCTGCACTGGAGAGAGAACGCGAGCAGATCCGAGTGCAGGAACTGGAGCGAAAACACGAAAAGAGCACG
CTCGAGCAGCAGTTTGGTCACGAACGCACGCTGCTCCAGCAGGAACTCGAGCGCCGAGACGAGCAGAACGACCAACTGGCGCAGCGCACGGCACAGTTAG
AAGATCAGCTACAGGGCAGACAGGATTTCATGGCAGGCTTGCAGCAGGCAGCGAGCAAAACGGACCAAGCCATCGAGGCACGTGCACATATATATCCATT
CTTTTACCTTGTTGTGTGTGAGCCTAACTTGATCGCTTTTTTGTCTCTGTACAGCTGTTAAAACAGCGCATTGCAGGCGACTCGAAGGAGCGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCAGCGTCGACTACGGGTCCTGGAAGACGAGAAGCTCGAACTGCTGAAAAAGAGTCGCGCATGTGCGCTGCAATAGT
ACACTTTTACATATATAAAAAAAGGTATGGACAATATCTCCACTCTCTCCTTCCATCCACTTGTAAGAGAAATAACTTGCACAACGCACGCCATATACAT
CGAATACTGTCTTGAACCCATTCGCATCTTCGTCTCAATTACTCGGCGCGCTGTGTGTGCTGCGACGCCGGCTGCT