Description :
From Genome Similarity Track
Location :
Scaffold_1960:1- 1955
Sequence
1954 bases(100 bases per row)
GATGGAGAGAGAGCTGCCAATGGGCGTCAGGGCAGATATCTATACATATATATCTATATACCGACTTTTCGTACTATAGTAGTTTCTGAAAAGTGTCATA
AAAGCAGCGGGCGTCACCGTCTTCTCTACCCTGCGCGTAGAAGCTCAATGTCTTGCTCTGTCACTGACGCAGTATCGAGACGCTGAGGTCCTGCCATGGT
GATTCGGAGCTCTCCCTCATCATGCGGTATTTTCGCGAAGAGATAAGTCCGCCCGTACCTGTCGTTAGGCCGTATCGGACCAGCCGCCGCGGGCGTCACT
CGTGGTGGTATCGAATAGCCCAACGTCCCCGAGCAGAGCGGATATAGTTTATAGTGGACGAGAGTAGACGAGCGGAAGGTAGACGTATCATGTAGATAGA
GAGGAGATACCGCAGCGGCTAACTCACCGCCGCGGCGGCGAGATACAGTGGTGGTCGCCGGAGCTGGTGAGCTCGTTGAGAAATGGGGGCTGTGAGCGTT
TGAAGGAAACAATCTTTCCGATGATAGAAAATGAAAAGCTATCTCAAATCGTAAGACCTTCTTAAACAGATTTAAAAACTCTTGATGTGCTGGAGTTTAG
TGTGGAAACGTATATTATCTGTATGTGATCATACGGTAAAATTCAACAGCACTACCAGCCCAATTTTCTCGTTATCCCACTAGTACTAGCAGGGTATTTG
TATATTGTAAACATCATATGTCTTTACCTCGTCATCATTTTTGAGAGTGAGTATTTTGCCAGACTGGGAGCATCCCACTCACAGCAAATCTTGTGTTCTC
TTCGGGTTTGATGGGATGTGCTGATATCTTCTATATCCGAACTGGGTACAGCGTATACTCTGCGTATACCCCTCCCACACAAATAATCCTCCCCCTTTAG
CAAATTCGTGGCGCCAACGAGCCCAAATGCCGCCGCGCCCACGCAGCGCTCCAAAGCGCCCCCTGTTGACAGACGCCAGCGACGATATCAGTGACGGCGC
CGCATCCGGCGGCTCTTTGAGTGAGTGGGATACGTCACTAAGCCCACCTCGCATGGAAACGACGGGGACGAGTCGCGCTAGCGAGAAAGCCGAATCAGTC
TGTATCATCGCTCCGCCTCCGGGGGAGACGCACTTCAGGTCGTGGGAAGAATTCGAGGCACATTTCGCGCTGTACCAAGCTCGGTCGTTCCAGGTACAGT
GTGAAAAGGTTTTTTAAATTGTATTCAGTGATATATAAGCTACCTGGTTGGCATGTTATCGATACAATCTTAGATCTACCGTACGAGAACGAGCATCTCA
GTTCCAGTACGGAATGCTCGGATAGATGCCCAAGGATCCAAGGCGTGTAAGATTCCCGACGAGTAGGACCAGTACGCCAAAACATACGTGTGTACGCATT
ACGGCAAATTCGTCTGGCAGCTCTCAGGTTTCTCCGGGCTCGATCCAGGTCGTCTTATCCGCCCTTATGATCCTCATTTTCGCCCCGTACAACGTTCGCC
GTCCGCTGAGCGGGATCCGCATCGCGTCAGGGAAACAAAGCGTCCCATCAGCCAGATCCAACTTCACTCCGGCTGGTACCGTGAAATCCCTCCCGAGGAT
GGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCAAACCAGTACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTAC
ACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTCACGAGCAAAGGCGGTATCTATTATAGACACCTCGGCAC
CACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGGTCTTGCCCCCTACTTTGGCTTGTCGGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACG
GGATTCTCCTGTTAGCAGATACCACTGGATCCCGTGGGTCTGACAGACCTTAGG