Description :
From Genome Similarity Track
Location :
Scaffold_1973:1- 1953
Transcript NameFunction/comments
Phymu_g13792reverse transcriptase

Sequence
1951 bases(100 bases per row)
GAGACAACAGTCTCAGGCAACCCGTGATAGCGGAAGACGCTATCAAGGAACAACGTCGCAGTCTGTTCCCCGGTGATGGTCTCAGGGACCGGAGCAAGAT
GCACCATCTTGCTCAACCGGCATACGAACACCACAATGCCGGTGTTCTTCCGGTCATCGGCCGGGAGGCCGAAGACAAAGTCGAGACTCATCGGCTTCCA
GCAGTCCAGCGGGACTGGCAGGCTCTGTAGCGGAGCCGACGCGTGACCCGCCGGCTTAACACGCTGACATGTTTCGCATGTCTTGATGTACGTGGCCACC
CACTTGTACATGTGGGCCCACCAAAACATCAGAGAGACCCCATGGTAGGTCTTCTCCCGGCCCAAATGGCCACTCGAAGGCACATCGTGTGCCTCATGAA
GTATATCATACTTCAGATCCTCGTCGTTCGGAACAACGACGCGCGGAGGATCGCCGGGCTCCACCCGATAGTGGAGTAGGCCATCGGCCCACTCATAGCG
GTGAAGCCGTGCCCGCTTTCGAGGCGTAAGCCACTCGACCTTGGCATCCGTGCCAGCGGACAAATACCGCACAATGGGGGCGAGGGTGTCATCGTCCCGA
TACGCCAAGCGTATTCGATCGTAAAGATCCGTTGTGACCCGACTAATATGAGCTAACTCATAGTCGGGTCTGTGCGACAAAGCGTCGGCAAGCGTGTTGA
GCTTGCCAGGCTTGTATTCAACGCGGAAGTTGTATTCCGCGAAGAATGACAGCCAACGCGCCATCCGCTGCGATAGATGCGGCGTATGGATGGCTGTCCG
CAGGGACGCGTGGTCTGTATAGACCACAAAGGGCCTTGTGCCCAGAAGATGCACCCTGAACTTGACAAGGGCGTACTTCATCGCCAAGAGTTCCTTGTCG
TGAACGGGGTAATTCCGTTCGGCAGCCTTCAGCTGCCTGGACTGGAACGAGATCACCCGATCTCGTCCCTCCTCGTCCTGTTGCAATAGCGCACAGCCAA
TTGCATAGTCGGAAGCGTCACAGACGACGCTAAACGACTTGGCATCGTCCGGCAACGCCAGGACGGGCGCGCATTGCAAGCTCGCCTTGATGCTGTCAAA
CGcatcctggtgctggcgctccCAGCACCACTCGGCATCCTTCTTCAGAAGGTCCGACAAAGGCTTTGCGAGTCCCGCATAGCCAGCACTGTACTTGTGC
AAGTAATTGGCTTAACCAAGCCACTTCCTCAGGTCCTTCTGCGACCGAGGAACAGGCCATGCCGCAATGGCTTTGACCTTGTCGGGATCCGCTCGGACCc
cgacgctgctgacgaagcagcCGAGGACCTTAATCTCCTCAGCTGCGAAGACGCACTTGTCGATGTTGGCATAGAGCTTGTTGGCTCTCATGACCTCAAA
CACTCGACGGAGGTGCTCTCGGTGCACCTCCATAGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAATATATCGTCAAAGTACGTCTGCGTGAACGCA
CGCAAAGGTCTAAACAACTGTGTGACCAAGCGATTGAAGGTCGCTGGTGCGTTGGATAGACCTTGTGGCATTACCAGCCACTCCCAGAGCATTCCGCTCG
GCGTGCTCACGGCCGTGAGCGGGATATCACACTCCCGCATCAGGATCTGGTAGTATCCATCCACCAGATCCAGCGCGCTGTACAGTGTGCAGCCGGCCAT
GTTGTTCAACAACACATCCTTGCGAGGGATCGGCGTCTGTGCTGGCACAGTCGCGCTGTTCAGCTTATTGTAAGCATGAACCAGACGCCATTTCCCGTTC
GGCTTACGAACGCAGAAAGTTGGCGTCGAGTGCGGGGACTTCGATTCCCGCACCATTCCCGCTTTTGCCTTCGCGGCAAAGAACGCGTCAATGACGTCGC
TCTGCTCTCGCGGCAGGGGCCATTGACGCGTGACACAATACTTTGTGCCTG