Description :
From Genome Similarity Track
Location :
Scaffold_1127:1- 1946
Sequence
1945 bases(100 bases per row)
CATGATCTATCCGCGCATGTTCACTCCCATCATCGCATTTACAAAACCTCACATGCTTCAAAAGATGCACCAAAAGTGTCGGTGCGTACGAGTTGGACTT
GACGCAACTTATCCAGAGGCGAAGCATCAACGGTTTGCTGCTTAGAAGGTCAAACACGACTCGTAACGGTACTTCCAATCGATAAAATTCACCACTCGCT
GTGTGACAAATAGCGAAGATCAGATCTCCCCAGTTCTCGTACACCAATGCCAAACACCGTAGCGAGCAAACGATGTTGCCACTGCATTGCGTGCCAAGTT
CGTTCGATCTCGAGGCTACCCTGTCGAAGATGATCATGAACATATATCCCCGAGAACTTCGAGAAAAAGAGCTCCACCATTTGCGGGCGCTGGATACGTC
GGTCATACTGTATTGTTTTCAGCTGGCCGTTGTCTAGGATGAGCTTGTGCCGTCGGCGAACGCTATCGTTGCCAGGAAGCGCCGTTCCGCGGTTTGAGAT
GAGGCACTTCGCTTTGCGGTCAGCCCAGCAGAGAGCATACATCGCGGTGCCTTTGGGAGTTTTGCTCTGTAGCATCTTAAATGACCCACGAGCGGGCTCA
GAACCAAACCACTCTGTCATATACTTTTTTGGATACTCGCGAGACGCTGTTTTGACCATTCCCATAAAGTAAAGACCGCAAAGATTTTCAAGTTGCACAA
GGGTTTTAACGAAGCAAAAGCGCTGTCTGCAACAACGGTGCGCCCGCTACCTTTATAAACTTCAGAAAACCGCAGAACAATCGCTGAACCCTCACCAAAC
AACGCGTGGTATGGCTTCTGGCGTTGACGCTCGGCTCCCTCCATCAAATCTAACCCCAACAGCACACCCGAATCACCATCAGCGATAGCTTTTAGTTCGG
CATCCACGCCTTCTGGCTTTCTTGGGATTTTTGTCTTGTGAGGTATGCCATCGTGGCAGTATTTACCCTCTTTGCCCTGCTAGGCGCTCATGCACTCATC
CACGCAAAGAATCTCCCCGGGTGATACTACATCGCGGCGGCGTGAATTATATCAATCTATTAGCGGTCTTATAGATTTCCATGGGTCATCTGACGGCACA
TCATCGGAAAAAGAGAGCGCAGCTGAAATATTTTCAAAGGCATGTCGTGTAATGCAGAAGCGCTCACCAAAGTTTGCGGCTGTGCCAACCATACCCTCAC
CAACTTCTCTTTCCCAGTAGGTCCGCAAGGGACCGCGTCTAGGCTCGACTGCCATCGCAAGCCGAACTCCCAGAAAGCGAAACAAATCTCCCTCAGCAAT
TGGACGTTGCTTACGCTCCACCAACTTGGCATTTGTGTGCTGTAGAGTAGTTTGTATGGTCGACCACGGGTACATCAGAAAAAAATATTTGGCGAAGGTC
TTTTCTCCTAACTCCAGCGTCGCCGGCCAGCGAAATTTTTTTTGCGCTTGCGTTGCAAAGTTGCAGGGTCGACAAGGAGGTCGGAGCAAAATTCCCAGAT
GCGGTTGTGGGCAAGTATTTTTCCGTCGTTAGAAATTCCAGAGACCATCGTAGACTTATCATCTGCGTTATCTTCTTCATCTTCCTCCTCGTCTGAAGAG
GATTCCGACTCAGAAGAAGACGAGTCACCCGGACCAGGCCCCGCACCAGCACCAGCTAACAGCAAAGCGATCATCGACTCTAAAGGCTCCGTAGTCGGGT
TCTGCATGGCTGAGTCGCTGCTGGGAGCCTGTAGTAGCTGTATTGAACGCGCCGACACTGACTGTACTGATCCATCGCCCCACTGAACGCTGTACCACGG
CTGGCGTTTGCTGTTGTCGATCGACAGGACAACGCCCTCCTTGCCCAGTGTCCCCTTAGACTTTCCTTGAACACGATTTCCCACACCGAGTTTCACCATG
AAGACAGCTTCGTTTGTGACCGGAAAAAAAGCGCTAAATAGCTCA