Description :
From Genome Similarity Track
Location :
Scaffold_1972:1- 1940
Sequence
1939 bases(100 bases per row)
TGCATGCGCGGTTGGGACGGAGCTGTTTGAATTAACGTTGCGTTATGACGCTGCAGTGCTCTTCCATAATTACGTTGATATAGATTCTTTTGAGGCGGGT
CTTGTTGCCCCTACGTTTTTGATTCCTACCATGATGACTACGACTTATATCCTGTCGATCTGAAGATAAAACATGTGCGCTCTTTCAACAAGGGAAGAAG
GGACATGCAGCCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATAGAAGGTAGAAACCCAGGCAGGTATAGGCTTAAATATCAATACAGACCTCAATT
TGCACAGTATCACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTCCGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTA
GTGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTTTACTCGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGG
TTACACCCTAGAGGTTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGAAACTACAAAGGCAAGGCAACACACCCGCAAGGAA
ACCCTACAGCCAGATCCACGATCTAGGCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACT
GCTGCTCCACCCCATCCCCACATCTCGCCAAGACGCTCAAGCTTCACCAATTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGG
GTACACAAGGTGAGGAAAGTTCAGCAGCACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCCAGCAATCTCG
CAGATTTTGCTGATCCCGCTACACCACAGAAACGCGGTTCGAAGCAGCTCACACAGCTGAGCCCCAGGATGCAAAGCATCCAGGCGATGTCGTCTCCCCC
TAGTGTACGCCCAGTAATTGGCACGTCCACCAAGGTTAAACAGGGCAAACGCCACCCGAACTGGCTCGTCCGAGATCAGACCCGCCTTCATGGCGATCTC
CATCTCACGGACCCAGAAGTGAAGGTTCTCTCCTTCCTTCCCCCCAAACGCGGGGACCTTCAGCCACACCGGCTTAGGCCTGGCTGCCTGGGCAGCGGCC
ATCGTGGCCTCCAAGCTCTCGCGGACGTGAGCGATGAGACCACGCTCGTAGGTCTCAAACGCAGTCACGCGCTCTTGCTGCTCGGCAGGCGTCGCCGCCG
CCAAGCTGCGAAGGACATCTTGTCCAAAGATGCCTCCCATATTTCGAACAAACTCGTACTGTGAGTCGTTTAAGCGAGGAAACTCGCTTCGGTCCATCTT
GGCTCAAACGCTGAGCGCACAGAGGATTCAGGTAGTTCAATCTACCCGCGATGGTGCTGGATTGACTACGAGTGCTACCAAGTGTGACGGGGTCACACAG
CACCTTGCACAGAGGAAGTGCTTAAGGGTATTAACTACCCGAGTGAACGTAAGTCCACGTGTTCCCGGCCTCAGTGGGAACGGTTTGCTACTTAGAGGAG
TAGAGTTAAGACTGGTGTATTTATAAGTAAGATAAGCTTGGATCTCATACAAACTAGAGGTTACCTATAGTGGAGCTAAGTAGTCATGCACTGACTGGTT
CCGAGAGCACCTGGTACCGTGTACCAGGTGTCCACAAGAGTGACGGGTCACTCTTTATGTAACATGGGGCACACTGGATTGTACCCCGTTACATCGACCG
TTAACATGCCTCGTGGCACTGCTAAGAGCGGTGCTAAGACACGCTCCAAGGCTGCAGCCGGTAAGGCGCAGGCCAAGAGCACTAAGCCTCACGGCAAAGG
CTCTGCACTCAAGGAGGCTACTCAGGTGGCCTCCGAGGC