Description :
From Genome Similarity Track
Location :
Scaffold_1679:1- 1939
Sequence
1938 bases(100 bases per row)
CTTTTGTCATCAGAGACATCTGAGCATGCATGCGAGGTCTGCAAGGGAGTTGTTTGCATTACTGTTGGATTTTCACGCTTCAGTGCTCCTATGTCGTGAC
GTTCAAACCGTACCTTTGGCCTGCTCAGTTGATCGCGGACTTTTGTTGCCATCTGAAGAAGGTGCTTGGAATGCTGCAGGGCGCCCGTGCTAGAGCCACG
GACAGCTGCAGGACACAAAGTGGTGGATCCACTGATGGCTGATCAACAGCATGTGGCAGAGCCACAGGTCGCGGAGCGAAGTGCTCGAGATGCAGGAGCA
AAGGCAAGCTGAACGTTCAGCCGAGCAGCTGGACGCTCAAGGTCCCGAGACCTGGTTGTGAGTCAACAGTGGTGGCTCTAACCTATCCACAAGGTGGATC
ATCTCTTCGAGATCGACCGATGGGCGGTGAACGTTCGCGTCGTGGACGCCGGCGTCGTATGAACGCAGACGCCGTTCCGGCAAGTGCTGACTCTCCCCGC
GAGAGCCCAGCTGAGGCAAGGCCTCCTCCTGCTCTGCTCGATGAGCATGGTGAGCTCCACTTTCACGTGGAACGCCTTGTGGCGTGGCGTAGACGCCAGG
GTCGTACCCAGTACTTAGTGAAGTGGAGGGGTTACCCTCACTCACAGAACTCATGGGAGTTTGAGGTTATCCTCCGGCAAGATTGCCCTGACGTCGTTGA
CGCTTACGACCGGGCACATCATGTGCCAAAGCGCCACCATGGCGTGCGACAGCGTCGCCAGGCGCTGGGCGCCTCCCACTAGAGTGGGGAGCGATGAGGT
CAGTAGTTGAGCTCAGGCTCTGACCAGTGGCTGCAGCAGCCTGCTCGTACGTATGAGCGGTGCTCGCAGCGGGAGCAGGAGGTGGAGAGACCTCGTAGTG
TTAGGGACATGGTCCCGAAGGAAGCAGGTGCTTCGTGTTGTGCTGACCAAGGTTCAGGCACAAGCGTCTCGATAGACGCATAGTTGTTTTGAAACAACTT
GCTCGATGAGCATGATCCAAATGTGGATGCGCTGTAACAGCGAAAGTGGTGTCCCGGACGGGGATCGAACCACTGGCCTTTGGCTTGACAGGCCGGAGCT
CTACCATTGCGATCTCGTACGTCAGTCCGAGAATCAGTGACAATTTCAAGTGATTAGAGAGGATTTGGGTTGGTGGCACGGATGCAAGTTGCCTGTGGTG
GATTAGCCATGACGAGCGGCACCCCGTATGGAATGACGATGGATCTGGTATGAGCGATGTACGGGAAGACAAGATCCACCAAGACTTATCTCGGATCCAC
CCTTACCTGGATTCACTTAGGTGGATATGGGATATACTATGTACCAGTGGATCGAGTGTGGATCCTATGAAGGAATGATGGTAGGTGCCATCCGAAGGTG
GATCTAGTAGATACGGCTAACGAGAAGTCAGGATCCACCGCGAGGCACCCCGGATCCCATACTTCCGAGTTCGGGTCCAAGGAGGGAGGATCCCGCATAG
AAGAACCTGGATCCAGGGTACAGGGATGATGGATGCAGTGGATCTCGAACCTTCGTGGGACAATGGAGATCACAGAAGGTTGCGAGATGATGTTGGATGA
TTGGACAGCTCAGATCCACGGCGAGTGTACAATTACAGTGAGGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATAGGGTGACCATGATGA
TTACGTCATGGATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGTAAGGGATTTGACAGGC
AAAAGACATAGAAGGTAGAAATCCAGGCAGGTATTGGCTTAATTATCAATACAGACTTCTATTTGCACGATAACACGCAAGTGCCTTCCTGCCCTCAAGA
ACCGGAACTACATTGGCCGTACGAGCTAGGAGAAGGTT