Description :
From Genome Similarity Track
Location :
Scaffold_598:1- 1924
Transcript NameFunction/comments
Phypa_INRA-310PPTG_20429hypothetical protein

Sequence
1923 bases(100 bases per row)
GGATGTGCGTACAGTGGATCTTCGACCGCGGTGCTTGGAATATGACGTCGACGAACAAGGCCTTCGCCTACGTCTTCAATACCCCTGCGGAAGACCACAA
AGTTGCACGCGTTCTGAGCAATCGCGACCCTGAAGAAGCTGTGACACTGTTAGGCCTGGACTCATTCGATTCCGTCACGCAAGTCAACATCCGATCTGTT
GCTTCGGCGCTGTTCATGTCTTCGTATGGGTTGGCTACAAGACAGTACAATATCAACGCTCACGTACTTGACACCCTCATGACCTACCTGCTCCGCCACT
ACCCAGCGCTGAAGTCCCTTGCGGCGGACAGCTTTGTAATTCATCGTTTGGAAGCTTGCGTCGTCGAGAGAGGGTTCTCCGTTAACGATCTCCTGGCATG
GTCGTCATACCTTGCCTCTGATATCGCCCGCAAACCTGAAAACACAACCGCGCAAAACACAACAACCGACGTCACGCAGCACCCCGTGTTTCTTCATCAA
ACAGCCTTAATTGAACAGTTAATCCAGGTGAACAAGACGTTAGACGCTCGTTTGTCTGTGATGGAAGCCAAGATCTGCAACAAACATCCGCGGTCACCAA
CACTGCAGCCGACAAGTGAGTACACGAATAGCGAACAACCACGGAAGCGACGACGTACCTCCCCTGCTTCGAGTTTGAAAGACGCTTGGTTCACTTGGTA
CACTCAAGAACCTCGTATGTGGAGATCAACGGATCCAGAGACCAAGCATGCAAGGTCAACCGCAAAGCAAGTAGTGGCATTTCTCAAGCTCTTCCTTGAA
GACGGCTTCAAACTTGTCGAGATTTCCCCGCGATATCGCGACGACGTTCTGAAGATTGGCGAGAATGCCGAAACCGCGCTGCTGGCGTTCCTCAAACAGC
ATAACATCAAAGCGCATGGCGCACAGAACGTGCTGAAGTCCATGCGCAAGCTTCACAAAGTCGGCAGGCTAAACCAGCACATTCTCCGTTATCGGCAACT
CCAAGCTTCCGGCCACATTCTGGATCCAGCTCCTTCACACACTACCAATACAGTTGAGTTAGTTTCAGGCATATAAAAACATGCAAGTTTACCTATTCAT
GTGGTCCAGCCAATCCTTCTGCGATCGAGCGCCACTACCTGTGCTGCCTCTCAGTCTGTATTTCGCACCCAAGCCCGCACAACTCCGTCTTCATGCCGTC
CATCAAGCCCATCAAGAACGCGATCAGCTCTTACAAAGAGTTTAAGTCGCTCTGCATCGCTGCATCAAAAAACAATAAGCTTCGGATTAGCGATGAGGGC
ATCCGCCACCTAAGACTTACCATGAACACGGTCGTCGCCTCTGCCGCGCTGCTGCCTGAAGCCATCGACGTTATCTACGCTTCGCTGTCTGAGAGGAAGA
CGCGACGCGCTGGCCTAGACGACATACGCGAGTGGCTTGTTGAACCACCTCCTGCTGAGAGCGATGAGGCAGTTACAGAAGGCGAGAAGCAGCACCACGT
ACGCAAGTTGCTGAATTGGAAGCGCCAGAACCGGGAGACGTACTACCTTGTCAACTGGGAGCCAACGTGGGAGCCGCGTCAGCACATCCACGCCTCTGTT
GTTGCTGCCTTCGAAAAGGAGCGCCGTCTTCTAGTACGCAAGAAGTTCTTCGAAGATGAAGCTGTGGAAGATAACACGCTCAACGAGACCGAAGCATAAG
ACTAGGCAAGTCTGAAGGGTTAATACAGGGTGTATTACAAGTTTACCGCTCGTAGTTGATATGAAGTGGTAGCACCGTATTGAACACTAAGCTTAACCTC
CATGTGGAACAGCAAAGTTAACCTCGTTACAGAGTACATTAAACGCACATTTTAGTACTGCATCGAACACAAAGCTTAACCTCCTTTCGGAACAGCAATG
TTAACCTCAACGCAAGCTAGCAC