Description :
From Genome Similarity Track
Location :
Scaffold_885:1- 1924
Transcript NameFunction/comments
g10706.t1hypothetical protein

Sequence
1923 bases(100 bases per row)
CCGGGAACCGGGAACTTGTTGTTCACCGAGAGCTTACGCTCTCTAGCACTTCCTCTGTGCAAGGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAG
TCAATCCACGCCTACGCGGGTAGGATTGGACTACCTGAATCCTCTGTGGTCTCAAAGACTGAACCACTATGGAACGAAGTGAGTTTCCTCACTTGAACGA
CTCGCAGTTCGAGTCCGTTCGAAAGATGGGAGGCATCTTTGGGAGGGATGTCCTCCGAGGCTTGGCGTCGGTGACGCCAGCCGAGCAAGTCAAACGCGTG
AACGCGTTCGACACGTATGAGCGTGAGCTCATTGCTCACGTGCAGGGAAACCTGCAGGCCTCTGTGGCCGAGCCGAAGCCGGTCCAGCCGAAGCCTTTGC
GGCTGGCTGTACCTGCGTTCGAAGGGAAGGAAGGTGAAAACCTTCACTTCTGGATCCGAGAAGTTGAGATCGCCATGAGGGCGGGTCTCATCTCGGATCA
GGGACTTCGCGTTGCGTTCGCGTTGTCCAACCTAAGCGGTCGTGCCAAGAATTGGGCGTACACGCTGGAGACGACGTCTCCTGGATGCTTTGCATCCTGG
AAACAGTTGTGCGAGCGGCTTCGCGCTGCGTTTCTCCCGGCGAACGATGCGTTCCGCCAGCGCTCACGCTTCCTCGCCTGTAAGCAAGGGAAGCGCGAGC
TGTACGAGTACGTACAAGAGATGCGCACGTTGGTATCATCGTTGGTGGGGAACCCCCTGCTCGAAGACGTCAAGACGACGGTCTTCATGGACGGCCTGAA
GGTCGGTCCCGCACGCAGTTATTCCGCGTGCATGCATCCACTATGGAGGAGGCGATTAAGATCGCCCTCCAGGAGGAGTACAGCCATAAGCAGGCTGGTA
CTCCGGTTGTTGCGCAACTTGTCGTTGCGAACAACGAGCCAGAGCCTATGGACTTAAGCTCTGCTGAGCTTGGCTCGGTCCGCTGCTATAAATGCGGCGG
ACTAGGACACTACCAACGCGTGTGTCCTTCGACTGGGGTGGGGAAGAACCCATCCCTCAAACCCCGAGGGCCTAACGGTCGCTGGCGCAAGCCGCGACCA
GGTGGCCGAGGGAACTCCGGCCACCAGTAATGGCGGATTCCCCAGAGGGGGGAGAGTTGAGTCTCCGTGACGGGTGTGCGGGTAGTGCACACCATGGAGG
CTTAGCCTACGAGAGACATTATGTCTCGAATCGGTGATGGCAACGCTGGGTTGCCGTTAGTACACGTGAGTGTACGGGGATGTTAATATCCCTAGGAACG
TTTAGTTCCAGGGGCGTCGAATGCTTTCGTACACCGCCGGAGCGATTGCCAACTCTCTGTGAGAGAGCATCGGCAATGGTCTGCATAGACCTTGCTGTCA
GGTTCACATACCTGAACAGCTGCGACCGTGGACACGTACGGCGTCCGCTTGGGTGCGCCGCGCCATGGACGCACGCACCCTGAAGAAATTGGTGTCGGAA
AGCCATCGAGGCTAACCGGCACCCAGTCTCTGGCAGAGCATTGGTGAGTCATGACCCCACCTCTGCCAGAACACACGGTATCCGAAAGGATTACCAGGAC
GCAATGGCGTCCGCCGACGTACGGAAGTCGTCGGAGTAGTTGCAGCTGCAACAGGTGTTGAGACACCGTCCACTGCGGGCAATGGACCGCCACAGGCAAT
GCCGGTGGACAGGACTAATAGTCCAGCGAAGGGAGCTGCAACGCCAGCAGCACCCACCGCTCCTGATCGTGGCGCCATACAGGCCTCGACTGTATCAGCG
CCAGGGGATGTCAGCTCCCCAGTAGAACAAGTCCACGTGAGGCCAAGACGGTCGAGACCGTGGCCAGGGCTGAGGTTGCCGAGAGCACCTCCTGTGTGGG
TAACAATGTTCCACACGGAGTCG