Description :
From Genome Similarity Track
Location :
Scaffold_4875:1- 1921
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_4875-fgenesh-gene-0.0U4/U6.U5 tri-snRNP-associated protein

Sequence
1920 bases(100 bases per row)
TCAGCGTGAGCAGCAAGAAGCGCTTCCATGTTGGTCAGCAGAACGAAGCCGTCGAGTTTCTATCGTGGCTGCTGAATGAGCTGCACCGGGTACGTGACTG
CTGAAGTAGTTTTCTCCCTGTGAAAACGATGATCTTAACAATGCGGTGAGATGCAGGGACTCGGCGGGTCGTCAAAGCAAGGCAGCTCGATTGTCCACAA
GTGTTTCCAAGGTCTCGTGGAAGTTCGCACGACTATTGAATCGCAGCCGGTGGCCCCGGAGGAGGAGCATGGGCACGAAGAGCAGAAGAGTGAAGAGCGA
CCACCACCGACTGCTGCGCCGGTGACCAAGACGGCCGTCACTCCATTTCTGTACGTTGTTCACCTTCACCGCACAGGAATACGGTGGATATCAGTTGCTG
AGAAGGATGCTGTTCTTCGTGAGACTAGGATGCTCGCGTTGGATCTGCCGTCGACACCGCTCTTCAAGGATTCGCAAGGTGGAAATATCATTCCGCAGGT
TCGTACAATGTCGGTGGAGACTCCTCATGTATACCCAACACACTGAGCTTCCTTCTATCCAGGTTCCGTTGTTTACGGTTCTCGAAAAGTACGATGGCTC
CCAAGTCACGGTATGCAGCACCATCGCACAGTTCAGCTTGTTAATTGTCGTGGTGACTGACTCGTGACTGCCCTCAGCACGTTCTGCAAGGCTCGCAGCG
CATGAAAAAGACCTACAGTATCACGTCACTGCCGTCGTACCTGATTTTCCACGTCAAGCGGTTCACGCGCAACAATTTTTTCGTCGAGAAGAATCCGACG
ATTGTGAATTTTCCAATCAAGAACCTCGAGCTCCGTGACTATGTCACGTTTGACACGAAGATGCCATCCGAAGACGAGCTGAAAGCCAAGTACGTGAAGC
CTCACAACGATATCTCTCATTGGTGGTTCAACTGGATCATTTATCTGACTGCTACTCGGCCGATGCAGATCTGTCTCCGAGTTACGAAAGTTGCTAGCGA
AGCACAACGTCTCGTCACAGGTTTGTGGTTTCTTGTCTGACATGATCATCATGAGCCATGATGTACCTACACTCTCATTTTTGTCTCGTAGGATTGTGTG
GAGAAGTCAGATCTCGTGGAAAAGGTCCTTCGAGTCGCTTTCCCGTCGACGAAGTACAACTTGGTCGCCAATGTGTGCCACGACAGCCCCGTGACCACGG
GCAAAGAGACAGCGGCGCTCAAGACGAATCCACTTACGGAAGGCACCTATCGCGCGCATCTTCAGAATCGGGTACGTGCAGGTACTGCATAACGTTGCCT
CGTCGTTCTTCATACTCACTGTTCAAATATCTGATGCCAGGCGACCGAGCAGTGGTACGAGATTCAAGATCTCCATGTGCAAGAGACCATGCCGCAACTC
ATTGGCGTCTCGGAGTCGTACATCATGATCTACGAGCGGAAGCAATAGACGATAAATGGACTTCCAATTTGCCATGTATACATTAATTAGGAGGCTGCGG
AGACACCGTAATGTGCATTCCACTCCGCAAGACTCCTCACCGTCTCGGCCGAGACACTAGCCCGCACGCGCTCACGTGCCATCTGAAAGTCAGACGCGTT
GATAGGGCGAATGTCTTCCTTGCGCACGTCCGCGACCCGCATACCAAGTGCTCGAATGGGACCAAGCGCTGCATCTTTACATAGCGCTTTTAGGTCGCTT
CCCGAGTATCGCTCTGTCGCTTGGGCAATGTTTCTCCAGTCCCGCGCAGTCAGCGAATGCTTTTGACCATCCAGCAAATGGCGAATCAATTGTTCTCGTC
CAGCAGCATCCGGAAGCGGAACTAAGTAATACCCATGTCAGAAGGGAGTCTCAGTCCCAGCGAAAATGCAGAAGCGTACCGAAAATGCGTTTCTCCAGTC
GCCGAATAATCGCTTCATCC