Description :
From Genome Similarity Track
Location :
Scaffold_1647:1- 1916
Sequence
1915 bases(100 bases per row)
TTACTGGTGTTGGAGAACCATCGGTGCCTATCGCATGATTGCCTTGTTGAAGCACCTCACACGTGGTAGATGACATACGGACTATGAACTTGTATCGACA
GGGGCAGGTGCCGCTCGTGCTCGATAGCGTGTCAGTATCAGTGTCGGCCGCAAGCTGCAGCCGTGACTTGCAGCGCTCAGATTTACACAGAGCAAATTGT
GAGCGCATTTTATGGCCACATCGATGCAAATCGTAGTTCTATTACCACTGTTGCAGATGCCATCCCAGTGCCTTTGTCTTTAACAATAAGCTGCTTCTCG
TATTAAGTGATCACGCTTCCTAGCAACATTTACGCAACACATTTCACAGAACGTACGCTAACCCCTAGGGTCAGTCTGTGGACTATCGACCCGTTTTGGT
CCAGTGAGTCACTGGAGTACAATTTTCCTTTATCCCAGATCGTATTTAAATGGGATCCTTTTAAACGCATCGGCTACGACATCCTCTTTCGCCACCCCCA
GGCAAGGCAAAAACAGATTTGCACTATTGTGTGGCGCTCATTCAAAGATCCGCGCACGGAAATTTGGAGTAGAGCGCACAATAATCGCGCAATTAAACCC
GGTGGGGGGGGCGTCAATGTAATAAAATTGGTTAGGCTGTCCAACCAGCTAAAGCTGTCCTTCCATTAAAAATACTGTAACGTGGTAAGAGCCTTGTCCA
AATAGAAAATTGATTATTTTTCTTACCTATTTTTTTTAAAGTAGCACTATGAAAAACGCGGTGCCGAGATTACTTTTCTTTTGGATAGTGACGGTTTATT
TGAGAAAGGATGTGGAGAAGGAGGGAGTTACTGTGGGCACGAAAGGCGCATACGACGTCGATCTGCGCTCGGAAACATCACAGTATCATTGAGAATATTA
TAGCCCAGCATATATGGGATGCCAGCGGGCAGTTCGTCGATGGCGTGTTTCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTT
CACTGCTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCTGACCATCCGCAGACAGACGGCCAAACAGAGCGCGGCAATCGA
GTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTTAACAACGCGGTGCACG
CGTCCACGGGGTTCACACCGTTCTACTTGAACGGCTTCCGTCACCCCAGAGTGCCTCTCAATCTTCGAGGAGACACTGACTCCTCTATTCAAAGTGGGGG
AGAGGCTCGGAAATACCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAAGTGGAATCCTTTATAGATACCAAGCGGAGCGTTGTC
AGCCGGGTCCACGATGCCATGGCAGCGGCCCAGGATAAACAAAAGAAGTACTCCGACAAACATGGAAGAGGAAACTTAAGTGTATTTAAAGTGGGGGACT
TAGTGTTACTAGACACGAGGAAGCTACCTCTTGACACTGTCAGCTCTATCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGTAGTCCTGGT
CAGACATGGTGCGTCGTACACCATCGACCTGCCAAAGTCAATGACGACGCACTCGACGTTCTATGTTGAACGTCTTAAGAGGTACTTTGATCCGCAGGGG
GTTGCTGACTCGCAGACCCCTCTTGGCCCAGCCCCTCAAAGCAAGGGCGGGCCACAGACGTCGACTAAGGCGTCGGAGCAGGTGCTCAAGCCTCGGTTTG
GACGGCAAAGCTGCGGTCAAGACCATACGCAGGAGGGGCTCCGTACGAACGGACCCCGGAGCCATACGCCGCGTACGCTGAGTACGCCGGGTACGCACCA
TACGCGTACGTCTGG