Description :
From Genome Similarity Track
Location :
contig_172:1- 1916
Transcript NameFunction/comments
g14559.t1hypothetical protein

Sequence
1915 bases(100 bases per row)
TGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTAC
ACGAGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAACAATTGCTTCGCATCCGCGCATGACGCGGATGCG
GCTTTCACGTCATCCAACAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCAGCCTCTTGCACCGCATAATCTGGTCGACGCG
AAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCCGCAAAGAATGACAGCCACCGTGCCATTCTTTGGGATAT
GTGCGGCGACTTGATCGCCGTACGCAATGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATAC
TTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACCGATCGTGATCGTTGCATCA
GTGCGCATCCGATCGCGAAATCGGATGCATCACACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTT
GACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTC
ACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACATTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGT
CAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCG
CATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTC
GGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTC
GGAGTGCTTACCGCTGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCA
TCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTG
TGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCTTTGCGACGACTTTCAAAGAAGTTGTCGATCGCCTTG
ACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCCTGTCCTGCGGTAACTCCGCAG
GAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAGGGGATCAACTTGAGCGGGTCCCAGCCCTGCTCGTCGAAGCGTTCCTTCTTC
GACTTCGCGCTGAGGGTGTCAGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCT
CGATGCGTCCATCGTGCAGTCGCGAGCGAAACGCTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTTCCAGCCTCATCTT
CTTGTATTGGGGACC