Description :
From Genome Similarity Track
Location :
Scaffold_961:1- 1906
Transcript NameFunction/comments
g10212.t1hypothetical protein

Sequence
1905 bases(100 bases per row)
TTGTTGCCGTCGGCCACCGAAAGTTCGCCCTCGTTTCGCTCAATTAAATGGGCGAACTTGGCCTTGTCGTTGCAGATGTGGTGCGTTGCGCCGCTGTCGA
CCGCCCACATGCCGAGCATATCCTTGCCCGTCGAAATGCCACACTCCAGTGAGACTGCGAACGCCACTCGATCATAGCCGTAGCCGTAGTCGTAGCTGGC
GTCGTCGTTCCTCCACTGGGCATTGTTGGCCCCGCGTCCACGGCCATTGCCATTGCCGCCGCGTCTTGGGCCCCGATTCTCGTCCTTCTGCTTGGTCCAG
CACTTGTCAACCGTGTGCCCCAATTTCCCGCAGTACGTGCACTGGCGAGACTCTCGGTCGGTGTTGAACGCCTTGGCCGCGTCCTCCGTTTTCACCGTCG
CCGTCTTCTCGCCTTGCCGCTTGATGTGCTCATTCGTCAGCACCTTCACGACGTCTTGCGATCGCAGCTCAGCGCTGCTCATCTCCAAGTTCAGCACGAC
GTTCTTGTAGCGGGGCTACACATTCGGTTCACCTCCCACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCA
TAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTC
ATTAGAAATATCAGTTTTAGGAGGAAACCCCTTTTTCAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTATCTAGGTTTAAGTA
TACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCCTAAGTAGTGGGTCTAAGCAGAC
CCACTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAAC
ATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCACGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAA
CAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGACAGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGA
AACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTAAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTC
CTCCGTTGGCTTGTCGAGGTCGACACTGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAG
CGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCA
AAACGAGTTCTGTAATGGGTCTGCTTAGACCCACTACTTAGGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAAATTACTTAAGTTCAGTA
TACTTGTATCAACAAGTATGCTTAAACCTAGATAAATGAACCAAACGGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCT
AAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCA
GTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATCCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGTG
TAGCC