Description :
From Genome Similarity Track
Location :
Scaffold_1944:1- 1891
Sequence
1890 bases(100 bases per row)
TCGAACGCGCCTGCGAAGTTCAATCGTCTAGTGACGCAGCTGTTCAGGCCCCACAGGACGTATGCTCAGACATACTTCAACGACATATTCGTCCACAGTC
GTGCCGAGCACGAAAAACTGATGTGGAGAACCACTTTGAGCACCGGCTCATACACAAGTTGAATGCCAACATTGACAAGTGTGTCTTCGGCGCTGAAGAG
ATCCCCTTTCTGGGATACTTCATTGGGAAGCGGGGTATTCGAGCGGATCCCGCTAAGGTCAAGTCCATTGTAAACTGGCCGGTTTCAAAGAACCAGAAAG
ACTTACGGAAGTGGCTTGGCTTTGGCAATTACTTGCACAAGTACAGCAAGAATTATGCTGAGCTAGCTATGCTACTGTCGAATCTCCTTAAGAAGGATGT
GGACTGGTGTTGGAACACTGGGCATCTAACGGCTTTTGAAGCCGTCAAAGAGGGTCTCCTTCAGGCGTCGACCTTGGCATTTCCAGTTCTTGAACGTCCT
TTTAGTGTCGTCTGTGACGCGTCAGACTTTGCCATAGGCAGTGCTTTCATGCAAGCAGACGCAGATGGGCGTGACCGCGTGGTCGCGTTTGAATCTCGCC
AGCTTAAGGCTGCTGAGAAGAACTATCCGGTTCATGACAAAGGGCTACTTGCAATAAATTATCCGCTCGTCAAATTCAGGGTTCACCTGCTCGGCTCCAA
GTCGTTTGTGATCTATACTGGTCCTGCGTTGCTACGCACTGCGACGCAGTCGCCTCATCTCTATTAGGGAATCGACTTCTTTGCGGAGCATAATTTCGAG
GTGAAGTACAAGCCTGACAGGACGACGCGTTATCACACAGGAGCTCGTTCGTGCCACGAAGGTGATTTCTCCTGTGCCAGTCTTAATCCGTACGCGCGCG
ATGATTCCTGTGGAGCCCTGGAGTTTACGACCTCGGACTTTAAACTGTCAGCGTGATTGCGCGTGAGGCTGCATCGATATACACGCGATGACGACATATT
CTACTGCGGTACGGGTTCGGAGGACACTCCACCTGTCGTGGTCCCTCATGATGAGAATCTTAAGTATCGGGTCCTCTATGAGGACATGATACACCACTGG
GTGGCCGTCTCGGTCGCGAGAAGACCTACAGCTCAGTGAGCACCCACTACTGGTGGCCGAAGCTGGACAAGTGTGTCAGTACGTATGTACGCACGTGTGA
GGCGTGTCAACGGGTCAAACCCTTGCAACACTCGGCTGCGCCGTTGGCCAGTACCCACGGGGTGCTGGCAATCCATGAGTATGGACTTTTTGTTCGGCCT
ACCGCGGGATGCGGCGGGCAACACGGGCATTGTGGTCTTATGGATCGCGTGTTCGTCAGCATGAGCTGCCTGAGGCGATTGTTCTCCGATTGAGACCCCC
GTTTCACGGGCTAGTATTGGACCTCAGTCTCTGAGGTGTTTGACACTCGACTTGACATGTCCACCGCGGAGCATCCGCAGACCGATGGTCAGACTGAACG
CGTAAATCGCGTATTCGAAGAAATGTTTCGAAGTGTCTGTGCGGATAAACCCAACCAATGGAGCTTGGTGCTCCCGCTCGTTGAGTTTGCATCGCACAAT
GTGGTGCATGCCTTGACAGGCTTTCACCCCGTTCTATGTGAACGGTCTCACATCCTGTTGACGCTATAATATGTGGTCCTGGGCTTACTGGCGGAAGAAT
AGCCGAAAGGCTAGCTGATATCATCCCAATTGCAGAATGCACGCAAGTTGACACGTTCGTGTCTACGCGTTTGAATGTCTTACGACAGGTACGCGACGCG
ATGGCTGAAATCCAGGATCTTCAGAAGGAACGGGCTGATGCAAAGGGCAGACGCAACGTGGACGTGTTCAAGGTCGGTGACCTAGTTTTA