Description :
From Genome Similarity Track
Location :
Scaffold_3837:1- 1855
Sequence
1854 bases(100 bases per row)
GGAGCGATCCTAGTTAGCGCCTCATCCATCTTAGCTCGAGGCGTGATGCTCACGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAA
TCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGAGTCAG
GATCCGGATGGATCTTCCCACTAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCCATTCATTC
GGCTTCAATGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTACCAGAGCTGCTGAGACGGCCCAGTCGCTGGCATAAACTATAA
CCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGCTCCACGAATGCATGTTGAGCTCGGATCCACCGAGA
TTCTACCTTTTCCATGTTCTGATCCGTGCTCTCTATCCAGATTGGGGCCTCGCTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTAAGGTCCTCTTCT
GGCGTCGTATTACTTGGATCCCTTCGTGGATCCGACGTCTCCAGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGGAGTGGTCATCGCAGCAAAAT
CTACCTCTCTCAATTCATATAGTACCGCAGCAAACAGTGCGTAATCCTCGATGAACCGACTGAAGTAGTTCAAACTGCCCAAGAAAGATTGCATCGCCCG
TAACGACTGTGGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGAATTCGCCTCCAATCCCTCCCTGGAAACTCGATGGCCCAAGTACTCCACCTTG
CGCATCCCCCAATAGCTCTTTACCACACTAATAGAGAGATTCCACTTAGTACACGCCTCCAGTAAGGACGTCACTCTCTCGCACAACGGATCCCACGATT
CCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGATGGGGTCCCAGGATCCCCTGGCTCCCCCCCTTCGAATGGATCCACTTCCGT
ATGCTCTTCTCCGGATCCACCCTTTTCGGGTTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGTGCGTTCTTCA
ATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAGAAACCGCT
GGTCATGTCAAGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCACAGCTCATTGCTTAGAAGCATCGGATACACCATCAATCGAGTCAGGCCGTTAA
CTAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCACAGGGATGTCGAGAAACTGATGATCTT
GGCTTGCGGCAGGCCCTTAATCAGATCTGATAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGATCGATCGGTTTCGCGTCGCCGACATCG
ATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAATGCATTACCTTTACCAATCAGCAGATGTCGGCTTTCCCAGCGTTTCTGACGTAACCGATCCACTT
CTGCGGGATTGTTTGCCCCTGGATCCTACTGGATATCGTCAATCGTGACCTCCTCTGTGGTCAGTGGTATCTCCTGGATCCCCGCCAGGCCATCCCCGAG
ACCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACTTGTTCATCTTCCGG