Description :
From Genome Similarity Track
Location :
Scaffold_1187:1- 1828
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1187-fgenesh-gene-0.0ATP-dependent chaperone ClpB

Sequence
1827 bases(100 bases per row)
GTGGGCGCTGGCGGCAGCGAGGGCTCGACGGACGCCGCCAACATGCTCAAGCCGGCGCTCGCGCGCGGCGCGCTGCACTGCATGGGCGCGACGACGCTGG
ATGAGTACCGAAAGTACATTGAGAAGGACGCGGCGCTCGCAAGACGCTTCCAGTCCGTGCTCGTGCCCGAGCCAAGCGTTGAGGATACGATCACGATCCT
CCGCGGGCTCAAGGAGAAGTACGAAGTGCACCACGGTGTGCGCATCTCAGACAACGCGCTCGTAGCCGCGGCGACCCTCGCGAACCGGTACCTGACCGAG
CGCAAGATGCCCGACAAAGCCATCGACCTCATGGACGAGGCGGCCTCGCGATTGCGGCTCCAGCAAGAGAGCAAGCCCGAGCCGATCGACAAGCTGGACC
GCGAGATTATCCTGCGCCGCATCGAGATCGAGGCGCTGCGCAAGGAGACAGACGCGGCATCTAAGAAGCGCATGGCGCAGCTCGAGCGCGAGGTTGAGAA
AGCGTCCAAGGAGCTGCGCGTGCTCCTGGACGAATGGAACGCCGAAAAGGAGAAGCTCGAGGCCATGCAGGAGGCCAAGCGCCGGCTCGAAGAGGCACGA
CGCGAGCTCGTCGCGGCGCAGAACAACGGCAACTATGGCCGTGCGGGCGAGCTCCTGCACGCGATCATCCCCAAGCTCGAGCTACAAGTCGCTGAGGAAG
AAGAGAAAGAGGTCAGTGGCGATGGTGAGCACGACCCCAAGCTCAAGTCCAGTCTCGGCGACGCTGTCACGGCCGACCACGTGGCCGAGGTCGTCGCGCA
GGCCACGGGCATCCCTGCGTCGACTCTCATGTCGGGCGAGAAGCAACGGCTGCTGCACATGGAGGAGCACCTGAACAAGCGCGTGATCGGCCAGCAGGAC
GCCGTGCAGGCGGTCAGCAATTGCGTGCGGCTCGCTCGCGCAGGGCTTCACGCGCACAACCGTCCATTGGGCGTGTTCATGTTCCTCGGCCCCACTGGTG
TGGGCAAGACGGAGCTGACCAAGTCGCTGTCCGAGTTCCTCTTCCAGAGTCCGCAGGCGCTCACGCGCATGGACATGTCCGAGTACATGGAAAAGTTCAG
CGTGAGTCGCCTCGTTGGCGCGCCGCCGGGTTACGTGGGCTACGAAGAAGGCGGGACGCTCACCGAGGCTGTGCGGCGCCGACCGTACCAGGTGGTGCTC
TTCGATGAGTTTGAGAAGGCGCACCGCGACGTATCCAACATCCTGCTGCAGGTGCTGGACGAAGGCCGGCTGACAGACTCGCAGGGCCGCCTCGTGGACT
TCCGCAACACGGTCGTGATACTCACGAGCAACCTGGGCTCCGAGATCCTAGCCAGCCTCCCTGAGGGCGTGCCCAGCTCGGCGGCCGAGGCGGACGTGCT
GCGCGTCGTGCGCGGCCACTACGCGCCCGAGTTCCTCAACCGCATCGACGAGCTCGTGCTCTTCAACCGACTGGACCGCGACGCGACGCGCTCGATCGTG
GACCTGCAGTTGCACCAGGTGGACCAGATGCTCGAGGAGAAGGAGATTCAGGTCAAGATCGACGCGGACGCCAAGGATTGGCTCGCAGCCACGGGTTACA
GTCCGCTCTACGGCGCCCGCCCGCTCAAGCGCCTGATCCAGCACGAGCTGCTCAACCCCATGGCGATCAAGCTGTTGGACGGATCGATCGGTCCAGGCCA
CAACATCCGCGTCAAGATGAACCCGCGCTATGACGAGGAGCTGCTGCGGGACCCGCGACGAGCCAAGCCTCTCATTGTCGAGTGAGTTAGTTAGTAGACG
TGATGCATCGATTACATGGTGACATTT