Description :
From Genome Similarity Track
Location :
Scaffold_204:1- 1824
Transcript NameFunction/comments

Sequence
1823 bases(100 bases per row)
GCAGTAGTAAAGGGACGAGAACCAGGATCTAAATGTGGCTATTGAATAATCTTTCTTTTGATTGAGCTTCACCGTTTGCATCACTTCTTCCACCTCGCTA
CTTCATAGACTTTGAAATGAAGGTGTATGTGCGCTAGTGAAAGCCGTAAAGGAAGGTGCGTTGGCGATTCGCTGTCGCTGTCTAAACCAGCGAGGTGGAC
GACCGATGAGGTAGTGAGCGTGCTGCAGCTTGAAGAGGCGGCCGAGGTGATGGCGTACGCGTCGCGGGAGAAGGAAACCAAGGTGAATGTGATGGTAAGC
GTGCTGCCATCACGCTGCAGCTAGAGAAGGCGCCAAGGTAATACATGGCGTAGTGTTGACAAGCGTGCCTCCATCACGCTACCGGCCAACGTAAAAAATG
ACGAGCGCGTTGGTGATCGTTAGATGTAGATGGGGACATGTATTCAATCACTGCTAACTACATTCTCTCGCCAAACGCTTCTTCAAGTGATCTTGCCACG
TGTGCTTCTTCAGTGAGTACTGGTACGTTTACCGCAGCATGGGCTTCTTTGAGTTTGTACAGCGCAGCTAACCTTCGTATGTTTCCTTTCTCCGAGAACA
GGTTGTTGGAGAGGTAATACCTGTGGAACTTATCCCAGCAGGTAAGGTCTCTTTCCGGGCACATGTAGTCTTTGGGCGTATTATCATAAACACCTCGGCA
AAGGCACACATTGTGGTTGCCGCAATAATCCGTCTTTTCCGTGGGCCAGCGATCCTCCCAACGACAAACTACACAGCCTCTTCGCTTGCGACTGCAGGTT
TGGAGTATCAGCGATGATGCTACGGCAATGCATTGCTTCCGCGGGCTTCCGTCTGGATTTGCAGACACAAACACTTCCTTTGGACTCTCACCACTGCCGT
TTGGGGGCGAAATACCATCACCTACGCCGATTGCGTCAAATGACATTCTGCTATCGCTAGGAGCGTCAGCCCACCTCCCTGATATAAGTTCTGACGCAAG
TTCAATGACAAATGTGCGGTGGGGATCCCGTTCCTTAGCCGTATCGACCACAAGCCGACGTGTTAGGTAGGCGTTTGATCGTGCAATGTCGAGTAGCGCC
AAAGCTAACTTTTTGTGCCATTTTTTGTAAGAGTGGCCATCCGCTATCGAGAACCGGGCCCGAATTTGATCTAAACGATCGACGCCTTGCATATTCTGAT
TGTACTGCTTCACACATGTAGGTGCCGGGTAGCTTTGAACAACTCCGCCCACGAGGCGATCCACGTGAGTCACCGTAGATGCATCAGCATTCGAAACCAT
TTGAACTATGTTGCCATCACACCACGAGGCTGCAACAATTGCATTGCCCGCAGACACACCCTGACGATGGTCACCACGCGATGATTCTTTCTTGTCGAGT
ACGGTATGCTTAGGGAAGTGCTTGCTGGTTCCTCGTACAGTCCCGCGTGCATACAGTCCGCGGAGGCGTAGTGCCTGCAGTAGTTGGACGGACGTGTAGT
AGTTATCCATATTCACGATGCGATTCGAGCCATAGAGAGGCCTCGTCACCTCCAGTACCAGCCTCCGAATGGAGGACACCTTCGAATCGACCCACTCTTG
CTGAAGGTTCAAAGCTTCATCAGCAGGTGCCACACCATCGAGTCTGTCAGTGAGATTACTATTGCAATGAAACCGATAATTGACCGCGACCCATGTTGTT
GCACAGCACAGCATGTACAGTCGAAAGTGATACTTGCCCGTAGGTTTCATAGGATTGAATACGATGCAGTGGCGCCCAAATCGAGATCGACATGCCACGC
TAGACTCATCAAGGGCTACGTCG