Description :
From Genome Similarity Track
Location :
Scaffold_3145:1- 1812
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_3145-snap-gene-0.1Kazal serine protease inhibitor PbraEPI2

Sequence
1810 bases(100 bases per row)
GCAGTGGAACCTGATCGAGCTGATGGCAAAACACGATCCGGCTAAACGAGTGCGTGGTGACGCCTTTTGCCGTGGACAAGCTTTTCGAGATCTCGGAGGC
GGAGAAAAATCGTGTAAATGTAGCTTTTGGCCCCCACGAACTCGCTCCTATGGAGCCCGCTATTCGACAATAAAATGTCCTACAAAGAGAGAACCTCTAT
GTATATGATAGTTGATTCTTGAGAACAAGGTGGATGGCGAGGGTGCACTGAAACTTGCAGTGGATGCGTGCATGTAACTTGGATAATAATTTATGGCGTC
TATATGGAGGTGATGAGTGTATATGCATCATTGTGCTGGTGTATGTCTGTATTTGCACACTTTGCTATATGCGTGTGTTGGTTCATTTCGCTCCGACGAC
GGCGCGGCACTCGGGACACGTCGGGTTGTGGCGCAGCCATGCCATGATGCAGTTCTCGTGGAACAAATGCGCGCACGGTAGCTTGACCGAGAACGTGCTC
TCGGCGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTGGCCGACGCTGGATCCAGATCGCGCGTGTCGGTGAACCGCAGGCGCTCGAG
GCAGATGCTGCATGCGTGCTCCGAGAGCGTCGGCAGCAGCTCTTCGACGTCTTCGAGGCTCAGGATCGCATTCGCGTAGATCCAGTTGCCCTCCAAGATG
CACTCGGGGAACGCGAGGAAATCACGCATGAGCACATAGATGCAGAGGATCTCGCGGCCCAGAGAGGCCGGGAAATGCGGCTCCACGGCGAGCGACGGGA
TGATGATCTCTAGCGCGCTCCAGCAATCGGTCAGGAAGCCCTCGAGCGCGACTTTGCCCTCGTTCATGGCGTCGACATTCGCGTTGATCGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTGCTCCAAAATCGCGCGGATCTGCGAAAAGAACGTACGGAACTTGGCTTGACTCATGGCGATG
ACCCACGACTGACACGATGCGCCCGCGCCCTGCGATNNNNNNNNNNCTGCCGTATTCTGCGATGTGAGCACGCATGTCGTACGCGTCGTCATCGTGATCG
CGACGCGATACACGACGGCCATACCGACGCACAGCACGCGCGCCTGCACGTGGAACGAGAACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGCTCCGTCGATTTCTTGGGCACTACAGGATGAAGAGCGTGGTCCGTCTCCTCCGCCATCTCCACAGCAAGCTTT
CAAATGGCGCGTCGTTCTCAACAGGTGTTATGTGGCTCCTTTGCTTCTTCCTTCAAGCGCGCGCAAACGTAACCAGATCCTACAGTAAACGGAGCTTGAA
GAACGTGTTTCTCTGGCGCTTCGTGCGGGCCACACGAACAGAGCTGCGCTAGTGGATCTTGTGAACCCTGTGGATAGAGATCTGCAGTATAGTGCGGGTT
CGCGGAACAAGCCGCTGCTTCTTCTTCGATTTTCTGCTGCTCTCGGGCGCGTGTGAAGCCGCCGAATGCGCCCCATGCCCTCGAGGATGCGTCCGTAGAC
AACGCGCGCACTCTCTCTCTGGTGCACGGTGCAAGACGACCGAATGTCTCGTTTTGGGCGCCTGCGAATGCGGCCAATTGGGGGAGCGGCCGCGCACGCA
TGTCGCAAGG