Description :
From Genome Similarity Track
Location :
Scaffold_3414:1- 1810
Transcript NameFunction/comments
Phyta_totarag15273hypothetical protein PHYSODRAFT_330603
Phyta_totarag15274hypothetical protein

Sequence
1808 bases(100 bases per row)
AGGAGCTCTACCGACGGAACAGAGGAGGGTCCGGCAACGGACTCGGAAGAGAAACCTCAACCTCCTCCCCAGGTCCCTCCGGGGACCCCACGGATCTCGA
TACGAATCGAGATCCAACCAACCACTCGTCCCAAGAtcgagcgccaagaagaagtctgcGAGACCGAAGCCCTCGCGGAAGAAAGTGAAGGCTCCGGACT
CCGACGCCGAAGATCGCGTCGATCCTGTGTCAGGCTGGACCGAGGAACAGCTGGAAGCTGCCTACTACAAGAAGAAATTACATGCCTTCTTGATCCAGAA
CCCAGTGATGCTGGTTCTCCGACCAAGGACCCTCGATGATCTCAAGGGTCCCGTGTCGAAACCGATCGCTGGGTCGAGCAAGATGGACGCTGTAAAGGCG
ttgctccaactgctgaAAGAGTCTGGAATCATCGCTGGCGCGTTCGAAGCTGACGAGCTCTTCGATCTTAAGCTTGGCGCGATCGAACATGCGCTCAAGT
CCCTcttcaagacgctgaagccCTTGGTCGGCGACTGAAGAAGTAGACtccgacagcgtcgacgacCCGCCGCGAATGACGCTGGGACCATCCGGCGCTG
CCATGCTGCGAGATCGAGCCGACCGAGCTGAGCGCGAAGCAGTACCTTCGGTCCAAGAGACGAAGGTCGCAGAAGTGAACCCGACACGTCACTCGCCAAA
GAGGCTGGAGTCGTACTTTCAAGCTGCGATGGGACGCTTCTTGAAGGAACAACAGTCCACTCCCCGTCCACGTGTTGCGAGGCCGACTGGGGATCAAGAC
GTGGGGATGGAGTCGGTTGGATCGCCAGATGGGAATACGATCCCGACGACCTCGATCTTACCACGACTACTcgcgcagcagtggcagcgacagcgacagc
aacttcacaGGCAGGAAGATCGACAGCTACTCCACGCATCCGCGTATCGGCAATGTCCGAACTGAAGGAATTCACCGGAAAGGAGGGTGATGAAGATCGA
GCCCGGTCCTGGATCGGCAAAGTGAAGTCAGCATTCATCCGAGATCAATCACCTGCTGATGAGAAATGCCTGGTCTTTGGTGATCTTCTTACTGGACCAG
CGCGAAACTGGTACCGGCAGCTGAGCCGCACGACTCGCAGCACTTGGAAAGACCTGCTGTTGTGTTTCCAGACGCAGTACTGCGGCCGTGGCATATCTGT
CGCGAGACAGTACTACCACGCGCGGAAGCGATCGGACGAGTCGCCGCTGGAATACTTGCACCGTCTCAATGTAGCTGGGCTTCGTGCACGACTCCAAGTA
AAGGATGGATCTCCGGAGACCCGGCGTGAACACGTCGACCACTTCATCGAGACGATGGACGATCGTGATCTCGCCGACCACATCGCCCTATTGCGAATCC
CAGATGCCTATACTTTAGAGGAGACGCTTCGATCTCGACAGCGTGCGAAGGCACGTCAGAGCAAGAACGTCTATGGATCGATCAAGCCCCGGACGAGATC
ACCGTCAGCCCTCACGCGATCAGTTCGCGCGATCTACGTGGTAGACGACAGTAGTGAGTCGGAAGCGGAGTCGAGCGGATCAGACGGCGAAGCGGGACTA
CGCAGAGTCTACCTGACGGCAGCTGGAAATCGTGACGAGCCACAAGATTGTAGACCACCGGATCAAGACCGCGATCGTACTGGCCCCACGAACTGGAACC
ACCAGCAAGATCGACACACCAGATCGACCGACCTGGGGGCGTCGGTGAAGCGATGCTCACACTGCGGGTCGCGCAAGCATACCGATCTTGGATGCTGGGG
ACGCTTGA