Description :
From Genome Similarity Track
Location :
Scaffold_3442:1- 1788
Sequence
1787 bases(100 bases per row)
CGAGCCCGGGGAACCTGGGAGCTGCCAGATCGGTAAGGTGTGATGGAACATGAGAAACTGTGAGTCACTCGGTGCGAGAAATGGGTGCCGACCGTAATCC
AGGGACCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATCGGACGATGGTTGGCGAAGGA
CGGTATCCCTAGGCGACCTGGATATGTGTCAGTGAAATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACCTACCGAGAATCGAATCTC
TCTCGAGAGAGAGTGGGAGAGATTTCCCCGCGCGCGCGGAGACACACAGTGTCCCTGGGTGGAAAGGGCCTTCATATCTCATTCGCGCAAAGAATCGCCA
AGGATCGCAGTGTTGAAATCTCAGACCAGGTGAGTGTGTATCCTCGCAAGGGGGAACATACTCCCAATCGCCATTAATAGCAGGTCGTGGATGAGGATGC
GAGGGTAAGCGACACCGGATCCCGCTGATCCACAAGTGGATCCAAGCTTTCCTTTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAA
ACCAGAACCGTCGGGCTTAAACTCGTTAGAGGACCGACTAGATCCAACTGGTGGTTTCCCTGATACCAGGGTACCTGATCCCCCGAAGACAGAAGGACTG
CCAGGCGAAAGAGGGTCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGGCGGAAGATGAGCAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCG
AGGATCTGGGAGAAGGCATGGCGGTGATGCCGGAGGTACCACTGACCACAGAAGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAATGAACC
TGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGGGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGTGGAGTCAAAGGT
GACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGGCGCCTCACTTCCGAGAAAACTATCGGATCTGATTAAGGGGCCTGCTGC
AAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCACAGATTACCG
GCTGGTTAACGGCCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGCTCTCTTGAC
ATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCAT
TTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAACGCTCTCTATGGATTCACCCTAAGACCGGAACCCCAAAGGGGTGGATCCGGGGA
AGATCATACGGAAGTAGATCCATTTGAGTCAGGAGAGCCAGGGGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATC
CCGGCGAAATCGTGGGATCAGCTGTGCAAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGG
GGACGCGCAAGGTGGATTACTTAGGCCATCGAGTTCCCAAGGAGGGATTGGAGGCGAGTCCTAAGGACCTGTCTTCGTTAGCCGATT