Description :
From Genome Similarity Track
Location :
Scaffold_592:1- 1787
Sequence
1786 bases(100 bases per row)
AGATAATCCAGCGGAGACTCGTCGGACCGCTTGCGAGCATGGTAATACTGGCGGGCGACGGAGATCCCCAATCCACAGTATTGGGTATGGAAGCTGCGAA
GGAGATCCGGCCATTTATTGCGTGTGGATCGAGGTAGTTGGCGGTACCAGTTCGGCGCCGATCCAGACAGCAGATCCGCGAAGGTCAGGCACTTCTCTTC
GTCAGGTGCTTGATCGCGGAGGAACGCAGACTTCACCTTACTGACCGAAGCTCTCGCTCGATCCTCGTCTTGGTCCTTGCCAGAGAACTCCTTCAGATCC
GAGACCGCTGAGATCCGGACTCGTTGGATCAGGGCTGAACCTGTGGATCCGGTCGCGGTGGTGGCTACTGTAGCGCGTGCTGGGGCCGGTAAGCCAATGT
CGTCAGGGTCGAACTCCCAGTGTGGATCCGGATCCGACGATCCAGTGGACTCCATCTCGACATCTTGGGATCCGTGATTCTGAACCGCCCCCGGTGCCAT
GGCTGGGGTCAAAGCTCCCTGCCCTTCAAGAACCTGTTCATAGCTGCCTGGAAGAACGACTCCAACCTGCCAGTCGACATGTCGGATCCTGATGCCGTCG
CTTTTGGATCCACTGATGGAGTTGACTGCTTCTTGGATCGAGGCTGGGATCGGGGCTGAGGACTCGCTTCACGTTGGATCTGGGCTCGGGCGCGTAGCAT
CGAGGCTCCCGATGGTCCAAGTGACATGTCGCGGCTCCGAAGACGTGTCCGACCCAAGCTCTGCAGCCGACACATAAGGTGACGACGTCCGACATCCTGT
GGATCCTTCTTGTAGTGATCTTGGATCCGGGATTGCGGGATCCGCCTTCGGCTGGATCTCGCCTACCAGCACCTTCAGCCGGTTGAACAGCATCTCCGTC
GTGGCACGGAGTTGGATTGGATCGATCTCGTACATCACTGACGCGTCGAACGCTCCAGCCACGAGACCGGCATCCCTCAGCAGCTGCATCAGGCGTTCCA
TCTCGGGCAAGATTCCTGGACGCTTAACGGCTGCCGGAAGTGTCAGGGGTCCCTGCAGGGCTCCGATCTGCTTCACACCGAACTTCTGCATAATTGGATC
CACTGTCAGAAAGCTGCGTAGTTGCTTCTCGTGATGACGGATCCATGATGCCTCGGATCCATCCTGGGCCGAGGTTTCTGGATCTTCGTCCTCCAGCTCC
GGGGCCTTCATCTTCCTTCTCGTAGCGGTCTTCTTCGTCTGGGTCTTGTCTGAATGGAAGATGTAGGGCTCTTGTTTGACTGGAGAGTCAGCAAATGCAT
ACCGATCCTGGCCAGCCTTGGTTTGTTTTGTTAGTGGATCTTGACTTTCGTCGCGATCCACCGGGGTCCCCGAAGGGACCTGTGGAGGAGGTTGAGGTTT
CTCTTCTGGATCCATGTCTGGATCCACCTCGGTTCCGCCGACAGAGGTCCTCCTTGCACTCTGCCGATCCGTGGATCTTGTTTCATTCAACAGCGTCGTC
GTCGATCCCGATTCCGAAGACGCTTGATCCCCTTGTTCCTTCTTCACTCGAACTTCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAGAAGATCCGG
GCACGCGCGCCATTGTGGTGTAGCGGGATCAGCAAAATTTACAAGATCGCCGATCCAACTTCCCAACTGCGCCCGAACACCGACTTACGGAGGGGGTCCC
CCGATGATCCGTGATCTGTGTGCTGAACTGGTCACCTTGTGTACCCGCCGGTAGGGCTGGATCTGCTCCTCTGGTGTCTGCTGAAG