Description :
From Genome Similarity Track
Location :
Scaffold_2279:1- 1780
Transcript NameFunction/comments
Phypl_g14904hypothetical protein PHYSODRAFT_332751

Sequence
1779 bases(100 bases per row)
AGGACTTCTTCCAACTCGTCAGCATCCGAAAGCCGTAGTAGCGTCAATTGGTCCGCCAGATCCTGATCTCCGAGCGTTTCGATGTAATGATCGACGTGCT
CGCGGCGGTTGATCTTcagtcgtccacgtagaCCTGCCACGTTCAAACGGTAGTGGTACTCCAGCGGTGATTCTTCCGATCGCTTGCGAGCGTGATAGTA
CTGCCATGCGACCGAGACTCCAAGTCCGCAGTACTGGACTTGAAAGCTGTGAAGCAGATCGCTCCACTTGTTCCTCGTCGATCGGCTAAACTGGCGGTAC
CAATGCTTGGCAGGTCCGGTCAGCAAGTCTGCGAAGGTCAGGCACTTCTCGCCATCCGAGGCTTGGTCTCGTAGGAACGCCGACTTGACCTTACTGATCC
ATGATCTAGCACGATCCTCGTATTGATCCTTGCCGGTAAACTCTTTTACATCCGAGATCGCAGAGATTCGGACACGCTAGATCAGTGAAGATCCGCTCGC
CCCGCCTAATCCGGTGGCGGCGGTTGGCACCACAGCACGGCCAGAGCTTGGCATATCGAGATCATCTAGGTCGTACTCTCCATGAGATGGACGATGGTGT
GGCGATCCCACCGACTCCATATCCacatcttgagctccgcATACTTCGatcgatctgctgcttctggtgTGATCGTTATCTGCTGTTCCTTCAGAAACCG
GGTCATGGCGGCTTGGAAGTATGTCTCGAGCTTATACGTCGGATCCTTCAGCGTCACCGCGTCTGTGATCTGGATAGCCGGGCTCGATGACTTCTTCTGT
CGATCTGCCTTGGACGGTACACGATCGGGGGACTTCAGGCGGGATCGCAGTAACGCTGCACCTGAGGGTCCTAACGACATCCGTCGTGGGACGGTCGAGC
TGTCCTAGTCTGGATCTGAAGTGGCCGATTCGTAATGCGATGATCCCGTTTGGActtcggtggtgctggccggTGTAGACAGCTGCCGATCCCGCATCGC
AGGGGTTTCACCCACTAAGAGCTTCAGTATCTCGACCAGCTTATGCGTTGCGGATCGGATTACCTCCAGATCTAGATCGAACAGATCGTCGGCATCGAAC
GCTCCTTCTACCAGACCAGCATCCTTGAGTAGTTCGAACAAGACCttcaccgcgtccagcttgttcGACGTCGCCGGTGGGGTCGCTACCGGACCCTTCA
GATCGTCGATCAGGCGTACCTGCATGATCCTTATCACCGCATTATGGACCAGGAAATCGCGTAGGGTCTTGGGGTGATACACGATCTCGATCGTGTCGGC
TGACCACGTCCCTGAGAGTGCCACAGTCGGGTCTTCCGCCTCTGACTCtggcgtcttcagcttcttcttcgcaaccttgcttttcttcttcttctgcgac
gATCTCGCAGGGATAGGAGTCGTCAACACATAAGATTCAGCCTGGACCTTCTTCTCTTCACTAGAAGTAGCGAACGCGTAAGGTTCGGGTTTGATCTTCC
TGTGTTCACTCGGCAGATCTCGATTCGCATCGAGATTTGCGGGGGTCCCCGAAGGGACTTGGGGAAGAATTCGAGGTTTCTCTCCTAGATCCGGATCGCC
CTCATTTCTGTCAGTCGAGCTCCTCCCAGGGCTATGCTGATCTGCGGATCTTGTTTCAttcagcggcgtcgtcgtcgatccgATCTCCGATGATTCTTGG
TCCACTTGTTCTTTCTTCACTtgcgcatcttcttctgcgaaCTCACAGTGAAATCCTGAGTCGCCAAGAGACCTGGGCA