Description :
From Genome Similarity Track
Location :
Scaffold_3454:1- 1764
Transcript NameFunction/comments
Phyta_totarag15295hypothetical protein

Sequence
1762 bases(100 bases per row)
TCACTTTGCGCGtgagtgcacagcacctgTGCACGGGCAGAGAGGCCAACGTGGAGGTGCAGGGCATCGCCGCGATCAATCTAAAAACGCGCGGAACCAG
TAGGCGCGGGGCGCCCTACTGGTAAAGCAGTCACGCGTGTCAACATTGGACACGCGTCAATGAGGACTGCAGTCCCCAGTGAGAGGCAATCTCACTGCAA
CAGGCGAGATGACAAGCCAAACCttgtcatcctggacgtgacGTCGAAGAGAGCGGACTCTCTTCGTGCCTTGGTAGACTCAGGTGCGTCGAACAACTtt
gttcgacagcaacgtcTATCAAGCCttgacttcgaggaggtgcaaaCACCTCAAAGTATattggaagtacgactggcAACTGGTGCCGTCATGAAGACTG
AGAAGCGTGTCGTACGCGTACGCTACTCGTATCAACAAAAAGAATTTGTTGAAGGTCCTATCGGCTTAGATTTAGACAACAAGGTCGACTTGGTACTTGG
CATGCCGTGCCTTGCACGGCACGACCCAAAGCGagactggaagaagcgtaCAATTGTACGCTTCGGTTGCGACAGCGCGACAGTGAGCGATGGTCCTATC
AGCACATTACACCACAAGGTGCATGCGACCTTCCAGTATAAACAGCGCTAACCGCTGCTGTAGCGACGGGCGGGGTGGGAATGAGCAAATCTCCGATGGT
TTCGGAAGTCGTTGGAAGTGAATATGTGTCGATTCTGAGAAGCTACACTGAGAATCTGGTAAGACCATATTTAGAGGATGATTCCGCCACAAAGGAACAT
TGTAGTCAGCTGACGCGAAGCTGAATGGATCAGATTGGGCAGGAAATTCGCCGAAAggcgtcgaggcgacgaaggcgcgtcAACTCAGGGAGTTGACGCT
GCGAGCTGTGCAGACGGTTGCAAACAACCAACACCAGAACATCTTGCGAGCTCATGCAGGGCTGCGGATGTACATCAAGCTGGGCTTGATGAcgcgcaag
ctgaagaagctgcgcgagtcTCGGTCCGGGACCGAGACGCTAATCAAGTCCGACGTCAAGCGTCGATCCATTGAATGGCTTGACGCAGACCAGTCCTGGG
CTACAGTACATGAGTATTCCACTTGAGAACCCTCCGACGAGTGCGTCGGAGGTGACGTCGCTCCCAGTCATGAGCGCGAAGCGTCTCGCGCGTGACTTGC
ATGATGGacgcatcgagcagatctGCATCCTTTCAGACAAGGAAAGGTAGACGTGCGAGGCGGAAGAATTGAAGCAACTCTTCGCTGGCAGTACCACAGA
AAGTGAGGACACtctcagcgccaagacgaagaagcagcgcttcgAAGACCAAAGTTGGGATTCGCTCACGTCGAGTCCCTATTACGAAATTCTGCGAGAG
TACAAAATGTACTCCCGGACGACAAGGAAATTCAGCACGGGATCGACCTCGTGCTGGGCACGAAGTACTGTGTCAtgcggcagtggccactgccgcgagA
GCAAGTAAAAGCGATCGCGACTTCTTCGAAAGTCGTTGCCAGACAGGTCAGGTCAGGTCAGGTGCCGATACCGCCAAAAGATGTGACCATTGCTTCGATG
TCCCTGAACATGCTCTTGATCTAAGAGACTGTTTCTATCAGATCTTAATGCGTGAGAGCGACATCCTTCTCACAGCGGTAAACACTCCAAGTCGTATGCT
TTGGGAGTGGCTCGTCATGCCGCAGGGGTTAAAGAACGCCCCTGTGACGTTCAACAGGTGCG