Description :
From Genome Similarity Track
Location :
Scaffold_1271:1- 1759
Transcript NameFunction/comments
Phymu_g13032hypothetical protein PHYSODRAFT_325775

Sequence
1758 bases(100 bases per row)
ccccccccccccccgccGGTTGCGATGGGAATCGTGATCCACAACCACTCTCCCCGCGCCTCCacgaagacgaaggcgacgacgaagccTAAGATGATGG
CTTCAGACGTGGAGGAGAGTGGAAAAGTCAGGACCTGGACTCCGGATCAGCTACAGAAAATCATCTGccggaagcagctcaacgcTGTCCCTCTAGAAGG
TCCCGTGATGATAATGGAGGAGCCGAAGCTGGTCTGAGATCTCCAAGGCCTTGTGGCCTGTCCGGTCAAAGCGTCCGATATCATGGTCGCGATCACTACC
TTGATGAACACGCTGGAAGAGGCCGGAATCGTCGCTGGTGCATTCGATGCGGAGGTGTTGTTCGATCTCAGCCTGGCCACCGTCGACAAGTCGTCCAAAC
GCTTGTTCAAGCTGTTGAAGCCGTTGGTGGGCGTGACTTCGACACTATCGAGCCTTGGCCCGACGGAAGAGTACCCCATCTCTGCATCCTCGCACTCAGG
ATTCGCGTCTGCGAAGGCGTCTGTTTCCTTGGATGACGAGTCCGACGGCGTGATCCAACCAGCAAGAATGACGTTTGATCCATCCGGCGCTGCCATGCTT
CAATCGAGGAAgatcgaagagaagaaggtgccCGTCAGCACCAGAGTGACGCCTAGGGCGACGCCCGATCTACACAGACCCGATCGTATACAGTTGATCT
TCAACACGACCATGGAACGTTTCCTGAAGGAACTAGCCGTGGGGACGACCGCCGACCAGCCCAAGTCGCCGGCACCGGGGTAGGCATGGAATCAGTGGAG
TCTCTGCATGGATCCCCAGACCAATACGACCCCGACGACTTGAGTATAGACGTCCCACGCCGAGCTGCTGTGGCCTTGGCGGGGACAACCACATCATCGT
CCGAGAGGGTATCCGCGATTCCCCGCGTCCGGATGTCAGCCATTTCcgagctgaaggagttctCTAATAGACACACCGACGAAGATCGTGCTCGAAGCTG
GCTGGGCAAGGTGAAGTCCTCGTTCATCCGCGATTTAGCCCCTGACGTCGAGAAGTGGATCCTATTTTGGAACCTGCTGACTGGACCTGCGCGGAACTGG
TACTAGCAACTGGGAAGATCGACCCGTGACAAGTGGAAGAATCTCCTGGACGGCTTCAGAGTCGAATACTGCGGGCTGGGTGTGTCCCTCGCGTGGTAGT
ACTGCCTTGCGAGGAAGAGATCTGACCAGTCGCCGCGCGAATATTTCCACCGCCTGACCGTGTTGGGACTCCGAATCAAGTTGCCGATCAAGCCTGGACC
GACATCCGCTATCCGAGAACACGTGGAACGCTTCATTGAGACCTTGGACGATCGCGATCTGGCGGACCAGTTGACGTTGGTGCGCCTCGGGTGGCCATTT
AGTTGGTGTCCGCCGTTCTTGGACAAGGCATGCAGCGCCAGACGTCTTGGATGCCAGGTGTGATTGGTGAATTCACAGGAAGCGCCAACAATACAATTGT
TGGAGCGTGCTCAAGTGTGGACGCGCTGACAGGCGTGCTGCGTATACGTCAGCGCGCGAAAGCCCGGCAAGGCAAGGCGGCTGCTGGACCGGCCAAGTAC
CGTCAGAAATCTCCATCGGCACCTCCTCAAGCTTCCCTAAAACATGCCCGAGACGTGCGTACAATCCGCATGACGAACGACAGTGACAATTCTGGTTCGG
AGCCAGAATCCAAAGGATCTAATCTGGAACAAGGCCGATCCCAAGTCTACCTCGCTGC