Description :
From Genome Similarity Track
Location :
Scaffold_3405:1- 1734
Sequence
1732 bases(100 bases per row)
TTTCCTCCTAGGTCTCTGAGGTGAGACCGGCCGCATTGCGCAAGCAATTGACGTCGTTTGTGAACGACAGGCTGAACGTCATCAGCCGGGTTAGAGAcgc
gatggcgtcggcccAGGACAGGCAAAAGGAGTACTCTGACAGAAGTGGAAGAGGAAACTTAAACGTGTTTAATGTGGTGGACTTAGTACTCCTAGATACG
AGGAACTTTTCTCTAAACACTGTTAGTGCTGTCGGTAGCAATAAGCTGAAGCACATGTTCATTGGATCATCCGAGGTCGTATGTAGGCACAGCGCTGCCT
ACACGACCGACTTGCCTAAGTCAATGACGACCCACCCGACGTTTTATGTGGGCCGTCTGAAGTGGTACCAAGATCCGCAGGGTCAAACTGTGCCACAGAA
AGTGAAAGCTGGCCGGTAGGAGGCGAGTACACCTCCACGAAACGAGATTGAGTTTCTGGCGCCGGGCGCCCAgcagaggacgacgaaggcgtcgtccAAT
ACCCGTGGTGGTACTCCTTTTGGTCGTACACCAGAGGCGCGTAAACCCGAGATCCGTAGGTAAAGCTCTCGTGCAAGTACGGTGCGACCCACTGGTTGTA
CACGTAAGGATGTTGGTTAGCCCCACGATTCGCGGAACCCTGGTCCGGGCGACGGACCTCGTTGGCAACCTGGTCGACTCGACTCGACAGACACGACCGG
ATTTAGCCCGAGCACGCAGATCGACCCGATCGTGCATCTCACGATGCTGGGAGTCGACGTGGCTCCACAGGCGGTCCAAGCagccgtgctggccagctgc
agcagcggttTGACCACCAGGGTCAACGTCCAGTGCCATCTCTACAGCATACAGACGCTCTTGGAGGGCACAAAGGTCCCGCTCCAGCAGAGCCAGTGCC
GAGTCCGGGGGTCGAGATGGCCCAGAGCCCTGGCCTCAGCAGACGGCTCGAGGGAGCGGTCGTTAGAGACCCCCTCCAGTCCAGTTCGACCTGGACGGGA
ATTCTCACTACCACGTGGAGTGTGTGGTCCGCGAGAGGTAGCACCACGggaagcgccagcttctaGTGAGGTGAAAAGGTTATCATCCTTCACGGAACAA
TTGGGAGCCAATCGAGTGGCTCCAGGCCGACTGCCCGAAGCCTGTCGGGATCTGGGAACAgaagcgacagcagcttcgtaaGTAATCCGCAGCTTCTTTG
CTGCTCTACGGGATACGGTTCCTGACGGATGGAGGCCGAATTCGCGCTCGTCACGAGCGCCGGACTGACCAGCACGCTAAGTACCTCCATCTCGGAGTAC
AGCTTGCGCTTACTCACGAGATGGGCGAACTCGATTCGTTAATCGTGCTGGTCCAAGACATAGGACAGCAAGCGATCCTCACGGAGTTCACGGAGCTCCT
GGGTGGAGTAGCTCCGAAGAGAGACCCACTTTCAGAAGAGTTCTCCGCCTCGACTTCAGCCGAAGTGTTCTCGGGCAGGACCCAGGGGAAACCCCAAACA
GGGTGAAGACCACCGTTGTTCTGGGCCTTCTTGCGAAGGCCGGTGAACTCCTTTAACAGAATTGTGTGTGGTGCTAGGAGCACACACCGAGCGGTTTCTA
TGTCGTTAGCGAATAGAGGCCCGTTCTGAACCAGGGCGCGTTCGTAGGCGCCTTTGGAGGCGTGACCCCCGATGAGGCCACGAGGgggcttgagctgctc
caagaACAACGGAGAGCCCGAGCTCCCATCGG