Description :
From Genome Similarity Track
Location :
Scaffold_2506:1- 1727
Transcript NameFunction/comments
Phyta_totarag14564hypothetical protein PHYSODRAFT_332751

Sequence
1726 bases(100 bases per row)
CAACTATCGCAATTCTGGCTGATCTTGGTCCGTCCTCGGCGTCCGTGGGTAGATTCCGTTACGGAGCATCTTGTACAGGTCCCAAACTAGATAGTCGGTC
TCCAGTAGTTGAGCTGATCGGACTTCCGACAGTCTGATCGTCTGGCAGAAGGTGATCACTGATCGCCTCAACTATCGCCCCTCCATCTTGCATTCCGGCT
CGATCCATCTTCGACACATCATCACTGGGCCGATTTTCACCTCGATCTATATCGTAAGCTTTTTTTGGCAGTTTGGACCCCGCTCGATCTGACATGGAGG
TAGTCCTCTGGTTCCAGACTCGCTAGACCTGCTTCGACCCTCTCTTCCTCCATCGATCTCTGCCCTTCGCCACCAGTGATAACCCgatcggacgacgagg
cctCCGATCTGCACTTCAAGACAGGTGAAGTAGCGGATCCACGCGTGATCTGGGTAATCCTGCCCCTCTGAAGTATGGCGCGTGGCGTAGGGTAGGTCGG
ACGATCGACGGCGGGCTCTGGTATTGGTTCCGGAGCCCCTTGCGCTGCATACTGCGCGTCGGCGGTAGCCTGGAAAGCGAGATTCTGCCACACCATGTAA
TGACGAGATCCGATCGACACGAATcctggaagacgaggaacacAGTCGCTGGCGAGCCAGATCCCGATCCTCTCATCGCCCTGCAAAATCAATTTCTTTT
CGCACACGTTGGCGATCTGCAGAtgtcgtactcgtccagGTCCTTTAGTAACCGTCGGTAACCAACGTTCACCACGGGTGATCCATAACTTCTCATGCTC
CGACGTTCGCAGGCGCATCCGGAGCTCCACCGACTCTCCGATCAGGATCTGCTTATACTGATCCAGTTTCAAGATCATCGCCTTGTCATTACAGAGCTGT
CGGCGTCCGCTGAGTCGGATCTCTACCTCGTCAGGCAGGCGGATCGACCCGACAGTCAGATCCAGTCTGATCTCCGCAGGaaccatgaagtccatgccTA
GGATGGCTTCCTGGCCAGATAGATCGCCTACCCAGATATCGAAGAAATACGCCAGCCAGCCCGCAAGGGTGACCTTGATCCGAGTTCTGTCTTCCGTCGT
ATACACGTTCTCACCAATTCCAACACACTCTTGATTGTGACTCGTGTCGATATAGCACCCAACCTTACGAGCAAAGGCAGTGTCCACTATGGACACTTCG
GCACCAGTATCTAAAAGTATGATAGCCTTCTAATTGTTGATTTTGCCAGTGATCTTGGCTTGTCAAAAACCATTTGCCCGGCGCATGATGTTTCCAATAT
CCTCGGGATTCTCCAGAGAGGAGATCCGTAGATCTTCCAGCGTCGGACCTTCGGTATTCATCAACACGGAGTAGACTTGGAGGTCTGGATGTGGCCTCGC
CGTCGCCCGGCTTGAACCACTTATCCGGATCTTGCTGTTTCCAATATCCCCTAGGTTCCCCAAGATGGAGATCCAAGGACATGGAGATGTCAGATCTGGT
ATATTCGTCCGCTTGGCGAAGACTTGAGACCACTGCAGTACATTCCCCGTGCagattacatgtattatcgGATAGATCTCGTTGCTTACTAACTCGATCT
ACAGATGTCTTGTTCACGAATGCATAGATGCAATACCTAAAACGCTCGGCACGTACCGGATTCCAACCCGGCGAGCGCCCTAGTTTAACCTCTTCTTAGC
CATCGCGGGCGACATGCCCGCACGCT