Description :
From Genome Similarity Track
Location :
Scaffold_3448:1- 1689
Transcript NameFunction/comments
Phypl_g15840hypothetical protein

Sequence
1687 bases(100 bases per row)
CTACTTCCCACCCGATGAGAGCTCGGGCTCTCCGTTGTTCtttgagcagctcaagcccCCTCGTGGGCCACGTCTCCAAGGGAGCTTACGAACGCGCCCT
GGTTCAGAACGTGCCTCTATTCGCTAACGACATAGAGGCCAGTCGGTGTGTGCTTCCAGTACCACACAAGATTCCGTTGAAGGAGTTCACCAGCCTCCGC
AAGAAGGCCGATAACAAGGGTAGACTTCACCCTGTTTGGGGTTACCCCTGGGTCCAGCCCGAGAACACCTTGACGAAAGTCGAGGCGGAAGACGTCTTCT
AGAAGTAGGTCGCTATACCGCCCAGGAGCTCCGTGAACTCCGTGAGGATCGCTTGCTGCCTTATGCCCTGGACCAGCGCGATCTGCGAATCGAGTTCGCT
CATCTCGTGAGTAAGCGCAAGCTTCACNGAGTAAGCGGAAGCTTCACTCCGAGATCGAGGGACTTAagcgtgctgctcagtcCGGTGCTCGTGACGAGCG
CGGATACGGTCTCCAATCGCCAGGAGCCATATCCCGTAGAACGGCTAAAAAGCCGCGGACTACttacgaagctgctgtcgcttcTGTTCCCAGATCGCGA
CAGCCTTCGAGCAGTCTGCCTGGAGCCGCTCGATCGGTTCCCAAGAGTTCTGTGAAGGAGGATAACCTCTCCACTTCACtagaagctggcgcttccCGTG
GTACCGCCTCTCGCGGACCACACACTCCACGTGGAAGTGGGGATTCCCGTCCCGGTCAAGCAGGACTGGTGGGGGTCTCTCACGACCACTCCCTCGAGtt
gcctgctgcagcgagtggCTCGGGACCTTCTCGGCCCCCGGACTCGGccctcgctctgctgcagcgggacTATGGTGCCCTCCAAGAGCATCTGTACGCG
GTGGAGATGGCTCTGGGCGTTGGCCCTGGAGGCCAAgccgcttctgcagctggacagCACGGCCGCTTGGACTGCCTGTGGAGCCACGTCGACTCCCAGC
ATCGTGCGATGCACGATCGAGTCGATCGCCGTGCTCGGGCTGAAGACCTGTCGCGTCTGTCGAGTCGAATCGACCAGGTCGCCGACGAGGTCCGTTGGCT
ACGTCGCTCGGACCAGGGTTCCGCGAACCGTGGGGCTTACCAACAGCCTTACGTGTACACCCAGTAGGGTGCACCGTACTTGCACGAGAGCTCCTCGTAT
GGAGCTCAGGTGTACGCGTCTCCAGCGTACGACCAGCAGGAGTACCGCCACGAGTATCCGACGACGCTTCCATCGTCATCTGCTAGGCGCCCGGCGCCAG
AGACTCAGTCTCATTTCGAGGAGGTACACTCGCCTCCTCGTGGTCGGCTTCCACTTCCGGTGGAACAGCCTGACCCTGTGCGTTCGTCATGGCGTCACGC
ACCCGGCTGATGACATTCAGCCTGTCGCCCACAAAGGACGTCAATTGCTTGCGCAATGCGGCTGGTCTCATCTCTGAGACCTGGGAGGAAAGAGCTTTCC
GAGCCTCTCCCCCACTTACGACCGAAGCCTCGGTGTCCCCACGTAAAGTGAGCGGCACCAGGGGATGACGCATCCCGATCGGGGTGTATCCCGTTGATGC
ATGCACTGCGTTGTTGAGTGCAAACTCAACCATGGGCAGCCGTGCTGCCCACGTGCTCGGCGCCTCAGCACAGACACTGCGCAGCGT