Description :
From Genome Similarity Track
Location :
Scaffold_717:1- 16762
Transcript NameFunction/comments
g17502.t1hypothetical protein
g17503.t1hypothetical protein
g17504.t1POM76328.1 Hypothetical protein PHPALM_6441 [Phytophthora palmivora var. palmivora

Sequence
16760 bases(100 bases per row)
TGTCCTGCCTGTTGCTGCTGCACGGGCAACTGCGAATGTTGCGGCCTGTATAACGTCAACACAATGGGTCGTTGGGGTTTCTTGATGAGCTCGGCCACGT
CCTTGCTCTCTAAGCCCAAGACCCTCTTCTGGTTCACGGCCAGGATCATGTCCCCCACCTTCACCTGTCCTGTGGCCTCCATCTCGCCCATCTGACCGCT
GTCCGTCTTGATGAGCTCCTTGATGAACGTCTCGTTCTGCTCATTCGTGTAGATGGACGCGTAGAGCCGCTGGCCCCAGAGCTGCACGCGGCGGACGCTG
CGCACGGAAGTGTCCACCGGCTCGTCCCTCTTGCGCTTCAGGCTGTGATGGCGCATAGTCGTGAGATACTCGTCCACCGGCGTCTCACTGGACGCAGGGT
CCTTTTGCGCGTTCTCCTTGGCGTTCTCCTTGGCGTGCGTCTTGGCCTGCTGCGCGTCCTGCAGGACCTCATCGGCCGAGAAAATGTCCACGTCACCGTC
GTCGAAGCTCACCTTGTAGAACAGGCCGCCCGAGACCCAGTAGCAGCCCACGACCGTCCCCCAGAAGGCGTGCGAGCCGAAGCTCTTGCGTACACGCACA
CCCATCAGCAAATCCTGCTCCACGCCCACCACTGCGGCCTGATACCGACGCATACATCGTTAAAAAATAGGATTATTAGAGCAGGACCGATGGTCTAGGA
CGTACCGGCATGGGGGCGTCGGTCTGCACCTCGGCGTCTACCATCCTGCAGGCCGAGCGTTCGCCAGTTAATTTTTATACCGGCTGGAAAAATTGTTTTG
GCGGCCGTATTTTTGGCGGGAGTTTATTATTGAGTTTGCTGCAGTCTGATTCGCTGAAAATAAGTAAATAGTGTGTGGTACACCATGTTGAAGTGTCAAT
CGCTTAGATGTTGAGCGTGGCGATGGAGCGTGCGCGACGGCCGTTGGACGGGACTTGCTGCTTGAAGCGCGTTAGTGCTGGAGGAATGCAGAGCTCGGGT
TTGCTGTCGTTGCGCCGCGCGGTTTCCGGAGCGGCCTGTTTGGCGCTCTCGTCGTCCATGTCGGCCTGCGTGAAAGCCTCTGACAGTCTGGAGCTGGTGT
CGACACTGCTGCGGACGTTGTTGTTGCCTTCGTCCGACTCGCCGAAGCTCTCATCGAGGAGTGGATCGCAGTCCGTTGCCTCGACGAGGACGGAAAGGTC
CTCCTCGCTCTCTGCCGTCGCGGGTGAGTCAACTTGGTTCGAGTACTCCGACTCCAGCTGCAGCGTGTGCAGGTCCAGTTCTGTCAAAGCAAAGAAGGTG
AGCAATAGAGCAACAAGCTTCAGCTAAGACAGACGCATCCTTACCGAGTTCCATGCTGGCGTCCTCGTTGTCCACGTTGTCCACAATCGTCTCGCTGAGT
GGCAAGGCGATCTCCTCCGTGTCGGCAAGCAGAGGCTGTTCGACGTCATCTTCGGCATCGGTGCTCATGACTATACTTCGCTCGGCGGAGATGGCGTCAG
TGCTCATGACGACGCGACGCTCGGCGGAGATGGCGTTGTCCAGGTTCGACGCGTAACTGCGAAGGAATTTGTTGAGGTTGTTTGACCGGGCGTTCTCGGT
GATCTCGGCCTCTCTGGCCAGTCCGCTCGCCAACCCGCTAGTCGACAGCACAGGGGCGACGCTGGCATCTCGTCGACGACCTCTCGTCTCGGACGTCTTC
TTGCCGGCCTTCTTGACGCTGTCCTCGGACTCGTTCACTTTCACGCGAGTCTCAAATCTGCTGCAGAGATTCTGAACCATCTGCCGAGATCGTAGCTCCT
TCAGCGCACTTCGAATTGACGACTTCATGGGACCAACCGGAGAGCGAATCTGGACGTACGAGAGGTCCGGTAGTGCCAGCTTGAGCCGACGTTCATACGC
AGGTTTCTGGACAACAATCTCAACGCTGTCGGCCTGCACATCATCCTGTTTCTTCGTGTTGTCTTTGAGCCGTCCGCTCAGCCAACCCCTGACTGCAAAA
CTGACCGCTGCCACCGCCACGAAAACCAGCAGCGCGATGAAAACTGTCATTGTGGGGTCGGTCTGGGGTGAGTCTCAGCTAAAGCTTGGTTTCACCCACG
GGTGCCCGACGGTGCTTATTTTTGAGTGTGCTCTGCAACAAGGATCTCTAGACTAAGCCGCAAGCCATCGTTCAACGAGCTCGCGCTACTGGCTCAGTCG
GTCGGGAGCCAATTTTGGCATGTCACCACCGTACTCGAAGTCTTGTCACCGGCCCTTTCACTATAAATGAAATTGGCAGCCACATTCAGGGATATGCGAG
CGTTTTCACTCGACATGATTCTAATTGTCTTATCTCGAATCCGACGCCGGCGAATGCACTCCGTGGTGGGCCCAAGCACGAATTGAGGCTCTATTGATCT
CTCGACTCAGGAATTCGCTCATCTACTTGTGTAGCCGGAGTGCCTTGCTGGATTAGGTAGCCATTAGGAGACGTGGGTTGTTGCATGTTGCCACCATGCT
GCTGCAACGACTCGGAGGCCGCGTTGGCTCCTTCCTCATGCATGGATGAATCAAACGATTGGAGTTGCAGCATCACCTCCATTGAGAGTGGCTGCTGAGC
TCGCTCAAAGCGTTCGCTTCGAGTTGAACCCCCACTCGGTCGATTAGACCCACTTCGTATCAAGAGGGTTTTAGCTGATCCGTTGAAGTGCTGGACAGCA
ACCATCGCAGCTTGTTTCAGTTTTCGTCCTTCGAGATTCAGATTCATATCGCTGGAGTGCTTGAACTTGGACAGAACCGACAGCTCCTCGGTTGACATGC
TGCGAAGGTAAACACAAAATTGCGTAAATCTACAGTAGAATCCTTACCGAACCAGCAGTGAGCAAACGTGCAGTACCTCCACGAATGCCGCAGGATATCT
TCCACGAGTGCATATCGATCCATCTTCTTCAGAATCCTCTTGAAACTCTTGTTATGCAGCCACACAGAATAGCAGCTCTCGCACGAATCCGATTGTCCTG
GTCGCTCTCGATGAACAACTTGGTTCTCACAGTCATGAGAAAACAGCATCACCCTGTTAACAAAACCATCAGAAAAAAACTCTTCTCCAAGCTCCCAGCA
CTCACTTGTCCGAGCGTAGATCCCTCACCACATTCACCCGATAACCACCGACATGGTACTTGGCAAAGGCATGGACCAGCTCCGCATTCTCTCGATAGAA
AACGTCCGGCACGACACCCGGACAGCGCCAGCCCGTCCTGGGCAAGTGGATCAACTTGACGTCCGCTGCGTCCTGCGCCAGCAGCTGCTCTGCTCTATTA
GTAACTCTCCTCTTCTTGGCAACGCTGCGTCGCGCCTCCATCTCCACCTCAATCTCTTGTCGACGGTTCTCCTCCTCTGGTGAGTCTGTAACCATGTCGG
AGGCCCCTCGATGGGCCACCACACGGCTCTTGTGCATGGCCCAGGCCGCCGTCTGGAATTTGCCGTTCATTTTGACCTTGAAGCCCTTGGGATCGTTGGG
TTTGCGGCCTCTGCGCGTCCTGCAGCGTGGAAAACAGCGGGAAATGAGGCATCGGGGGGGGGGGGACTGCACAGTGGGGAAACGCTGCTCACCGGTCGTA
CAGGGCCGCGCACGTGCGGCATAAGACCCACTCGCCATTCGCCTCGTCTAATTCCTGCACCTCCGGGTCCTCGCGCACGCTCTCGGGCCACTGGGAGCGG
CGGCGCCGCGCCGCAACCTCGTACGGAGCTAGGAGCATGTGGTAATACCGCCGAAACAAAAAGGCGAAAAAACGGTTTTTTACAAATTAATGTATCCCAA
ACAATTGAAACCCGCCAACGCCTCCTAGAGCTTTTGTTGCAAGTGCGCGCACCTGTGCGGAAATCTAGTGAAGTGCGTCCCATGAGGAGCTAATATGTGG
ACATGCCTCGTGTGTCTGTGTGCCTCCATGATAAAGAACACAGCCTGAACCGCTGCTAATCTCACTCTCTCTTTTGCATCTTACCGCCGAGTTGGCCGTG
CACGCCGTGCGGAGCGGACGATCCTGTTTCACCATTTAACATGTTATGAATTCAAGTACAGCCAACTCTGATAGCCATGGCGCTGCAGACATCGGTGGTG
AAGCTTCGACGCCAAGCGTTGCCCCGATTCGTGCACTAACAAGAATGGTCGAAGAATATGAAGAGAAGAGCACTGCTGCTGTCGATGCGAGTGACAACAT
CCCTATAACAGCGCATGGGGGGGGGGGGGGGGGGGGGGGCAGCCAAGGACACAGCGTAAGAAGGGTTACGGTATCCGGACGTACGCCAAAAGATCCATCC
ATTTGATGGAAAGGAACTGTACGAGGGCCTCGGTCTGAGTTCCTGGAGTGGGGACGTCAATTCGAGAGGCATGTGATGCTGGTGCAGTCTTCATGCGGTT
TCCACTGACCAGAATACGCCAAAGTGGATCAGCTGGGACACTACCTGCAGGGTATGGCCGAACGATACTACAACAAACAGCTGGATGTCTGGTCGGCAGA
GCTGCCAGCACTACAAGATGACATGGAGTGGGTGCTCGCGTCGTTCATAACACACATCACACTTGCTCAAGCTATTCACTATCGCAAAGGACTCGAAACA
TTTCGGGTCGGAACACGTTTTGCACCTCGTCACTGTGGCTGAAGTCTCGGGTGGAGGCGCTTAGTATCTGGTGACAGCATTATGCAATACGCATCGAACG
GCACGCGCAATGTCCTGGTGACGAAGATCGATGGCGTGCGGATGGACCATCTACAACAAGCTGAAGAGCTCGCTCACTTGGGAAGCGAGCGCAAGAAGCA
AACACATAGGGGGAGACGCCGTAAACGTACGCAGATGCGAGGATCGCAGATAATACACGTGCCGTGAAATTGGGACACCTGAGGGCTGCCTGTCCGAACT
CGAGCAGTAGATTTCAAGACGGCCACGACGCTGATCTCACGCTCGCAGTATCCGCTGGGTTTGACATGGAGCACGACTATTCGATCATAGATAGTGAGGT
GAAGCGACTTGCCAGTTGGAGAGATTGAGCGATTCGGAGGGGACTGATGGCATGAGATCGCGTTTGGAGGAATCGCGATGGAAAGATTGCGGCTGTGTCC
AGATATGGCCAGTGGTGTACAGTGGTGTATAGTGGTGTCCAGTTATGTCCGGTTGTGTTCAGAAGACATCCACCTCCGGATCGAAGTGGATACATGTCGA
CCTGATGAGTATGGCGTAATCATTTATGCCGACCTGATCAAGATCGATATTGAGCAATCATTTCGATACGCAATCTGATCCAGATCGACATGCGACAAAC
ATTTCGACCACGATCTGTACTCACAATTATTGTGGGTACAATGGACCAATCTTTTCGACACGGGTACCGCGATCTTGGTACATCAGACCAAGTTCAAGCT
ACGGTGTGCAATCAAGGGATGCGCAAGCGGGATAGGGAGAGAGCAGGATAGGGAGAGAGCAGGATAGGGAGAGATCTTTAGGACCTTTACTTTTCGTTAA
GAGATTCTGATTTGCCTTGCAAGACACAAGTGGTGTCCATACTTTCCGGTGAAGGAATTACATTGGCCTACCCGACGAAGGACCCGCCCAGTCAACCAAG
GACACGACTCAGACCTGGATAGCTTGGCCAGGGTGCGATCGCATACTCTCATCTCAACTCAAGACCCCGCCAGAGGAGGCGGCAAGCAACGGAAAGGGCT
ACAACAGCATACACCCAATGTAGCGGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCGTACATTCAGGTGACCACCACAGGG
TGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAAT
GGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTTCGTTTGGTTCATTTAT
CTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTG
GGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACTGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCC
CTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTC
CAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGA
AGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTAAAACTCCACGTAAGCAGCTACGTTGGAAGAGA
GGGCGAGCCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGT
CTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAGGATTTCAAGGAGGAGCTCAAACAAGCGT
TTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTACTT
GGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCGTGAAAGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGA
GAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCATTGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCGCGGCCGATAC
CACGACCGGTGATAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACCGCTGCTGATTCCCAGCAGCGTCGTGGATCAACGAGTGTGCG
TTGTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACCCAGTATCGCCACGGG
CAATCAAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCC
CCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGT
GGACTGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTA
GCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTACCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGG
ACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAG
CAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGACCCTCCACTAGAGACAGCGCGGAATGCGGCTGTCTCCGGT
CACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGGAGAAGATGTGAACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCG
TCCGGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCT
GGGAGCCGACGTTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAGATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGC
GATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCG
GAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACTGTGGCGTTGGGTTTTGGTGCC
GAACTGTCACGGTTTGGCTGATGTTGCACCTTTCAGTGAACGGCGACAGAGCGTCTTGATTGGCGGGTCTCATTTCCCGCGCTGTAGTGACCTAGGAACA
ATAGTGACCGAGGTCTCGGCTGGGTCTAATAAAACCCCGGCCGAGGTTAAAAGCCTCGTTTGTACCCATTTCGTGTCGTACCCTCGGCTGTGTAGAGCCG
GCTATACGATTTCCCACAGAGATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCCAAATGATGACCTACAGAGGCTCCCAGAGCTGTAGGA
TAAGAGAAATAAATCAGCAGTCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGCTCGGC
TGCGTGGGATGCCTGTCAGCGAGCTTGAGGTACATTGAACCGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGTTAGGGACGACAAG
GAGTGTCGGTCCCTATATATTGGTGGAACCCGAGTGTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGGCAAACCCGTATTAGGCGTGACTGC
CGGTACCCTTACTTCTGAGGGACTGCGGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGAC
CGAACTCAACCTTGGTATACAGAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCGTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCG
AGGGAAGCGTGTGTTGTTGGTGGGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACAACTGGTGCCGCGACCCGGGATTGGTGTGA
CCTTCTGTGTGTCTTGGTTGCATATAGGTCTTACCTTAACGAGCATTCGAGAGAAGAAAGAAGAGAAGAAGAAAGAAGATGGCGAAAGAAGCGAAGTCAG
CGGTACCAGCAACGCCGGCGAGGTCAAGTGGAACGCGTACCGAGGGTTCGGGGCGTTCCGGTTCGTCGTTCGCGACGCCGAGTACGTTGGCGTCGATCAA
CGAGCGTTCGGACAGTTTTGATGAGCCGATGGACTATTCTGACGCCAAGGAAGATGACGAAGAAGATGACCTGGAAGAGAAGGCAGCTATGCCCGAGCTT
TCGGAAGCCGCTGCAGTATCTGCAGGACGCAGCGGAGGGGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGAACGAAGTGGCTGGTCCCGAACCAG
CCAACGGTTACGACGAAGATGAGTCCGACGATCACCGATCGTCGGCGATGGCCGAGGATGCGAATTCTCGGCCGAATGGCGGCCGGCCTCCTCTTAACGG
AGACACCCCGGCCGCCAACCGAGTTCTGGGTCGATACCTAGAACTCATGAAGGTGAAGAGCAATTGGATGCGATCCTTCGCTCCAGAGGTTGTTCGCCAA
GCCATCTGGATGGAGCTCGGTGGCGAGTTAACTGTGCCCGTGGAGGCGTGGAACACTCGGCAGGTGGCCGAGGACACGGTGCAACTCCTACGCGCTATGG
GATGTGAACCCCAAGTGTTCCCATCGGAAGCAGACCTCCGAGCATGGGCACCCGAGGACGCCGCTACGGCGCTTCGCAAGTGGAAGCAGAAGCTTCGGTC
GGCCTTCGGGGTGGCCGAGGCGGGAGTTAGCCGTCCACCGAACGTCCGCCGCGCATCGGATCCGGTCGACCCGTCCATGATTCCGTTGCCAGTGACCCCT
GGGAGACGCCCCAGAGGGTCGACCGAGGCCGGAGTATTTTCGGCCCAAGGTGCGACGTCGACATATTTCCAAGACTCTCACATGGTGACGCCGAGGTCGG
TCAGTCGCACAGAACGACTGGCGAGAGAGGCCGAGGGGTATCGAACCGCTCCGACTGCTGGACGAAGTGCAAGTCGGACGCCCAGCCGACGTTACGACCT
CCGCGATGACTCATCTGACGAAGATTCGTTCGACGTCGGAGACACCGGAGGTGACTTGACGGGAGAATGGGCACGCCAAATTCGTGAGCTGAGCGCTGTG
GAGAATGACAGTGCGACACCGAGGCTAGAGATCGCTACGCATCTCCCACTCGGAAATATCAAGCCGTACTTGGGACTCCGCGACAAGAGCGAGAAGTCCA
TGCAGTGGCTCCGAGCGTTCATATACGAGATGAAGGGGACGCACACGCCGCCTAACGAATGGTGCATGGCGTTTGAATTGAGCCTCCAAGATGGTGCTCT
GCATTGGTACCGACAGCTGCCCCGCAAAACGAGGCGCACGTGGAAATTGTTGAGCGATGCGTTCATTAAGTACTACTGTTCGAGGTTCAACCAGTCTGCG
AAGGCTCGGTACTACTCGGCCAAGCGAGAGGAGAAGGAGCATGTCTGCGACTACCTCAACCGACTTAACGGCTATGCTCGCAACGCCGGAGTGCAGTTCG
AGCATGGCGGTCGTGATGCAAAGGACCACGTCGAGCACTTCTTGGATTCGTGTGAAGACCGAGGTCTAGAAGAGCGTCTGTGCCATGTCCGAGTTAAAAA
CATTCACGACCTCGAGGATATGATCAATGATATCCTTCGTCGCAGGGAGCGAAAATCTGGACGCGAGTCCTCGGTCCGCCGCCCTCGAGGGCAAGAGGTA
GCACGCCGACGCGATGGTGGACGCTCCGAGGATCCGCGGGACGGCTATCGCCGAGACCGACGTCACCGAGAGGACGACCGTCGTCGAGAAGACCGTTACC
GAGACGATAACCGTCGCCGGGATGACCAACAATATCGACCGAGGGTCACTCTCACTGACGCACTGACCAACATAGTGACAGCACTGAATGCGGGACGCTT
GGTGGACGCGCGTGGAGGATACCCGGAAGCGTACAACGACGGATATGATGACACCGAGGAGTATGGGCCGGAGTCTCACTCTGGCGATGACGACCGATAC
TCCGAAGGGTACTCGGACGACGGATACGCGTCGACCGAGGACCGAGGCCACGTGGCTGCTGCAAACGACTCTGAACGTCGCAATGCGGCTGAAGGAACGT
TCGCTCGCGCCGACAACCGTCGGCCGAGGGCAAGTAACGGCCAACGCCCGTATGACCGAGACGACCAGCACCGAAACTCCACCGGACGCGATAGTCGACG
CCAATATGGTCCATGCGCCGCCTGCGGAGGACTCACCCATTCGGCTCACTACTGCTTTAAGCGATGCAAGATGTGCAAACAGGTTCATGATGCCGGGAAG
TGTGAAGCCTTCCAAGAACTCACGAATCTCCTCCGAGCTAAGGTCGAGAAGAAGGACCTCTCGCCGGAATTGCAGGAACTCGTCTATGGGAGTCATTTAA
ACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTCCCAATCGGGCTGCCACAGTTAGCCAAACCTGCGCTGGATGCGGACTATATGTTCGCATTCGCAGGT
GTGAGCAAACGGCCTGATGACTTGAACATGGAATATGTGAAAACGACGGAAAATGTAAAGGAGAGAGGCGTAAGCCTCGGTGAGAGTGAAGTGAATGGAC
GACGTGTGGACGGAGACGGAGTGGAGCTAACCGATGCTTCGATCCTCAGCATGGCCAAAATCGACCATCCATCCCGAGACCTCGGCCAGACGATTAAACT
GTTATCTGGCGAGAGAATGGGGTGGTGGTCATCCCAGCGCTATGACAAGAGGAAGCGATTGCGAGCCCTCGTCAATGGGGCTGTAAACGACTCGCGAACG
AGGATTCTGCTGGACACTGGAGCGAATGTCAGTGTGATTTCCGCGTCATACGCGAAACGGTTGCGCTTGCGCGAAGTTCCAGACCACGGTAGGAGTCTGG
AAGTGCGAGGAATTAATCCAGGGGTGATGGAGACCCGCAGACGAGCGCTCGTTAAAGTCACGCTAGGCTGGGAGCGCGTGTACGAATTTGAAGTATGGGT
TATGGATCACAGTGCAGGAGTAGACGTGGTCCTGGGAACAGACTTCATGATTCCAGCCGGAGTCCGGTTGGATCTGTTCCACGATACTGCGAGACTACCG
GACGAGGTAATGGTGCCCCTGGTGAAGTCGCAGAACCCAGCAGAGGCTGAGCCGTACAGCATGCAAGTGACTGGACGCCCGACCGAAGATTTGTCGGTCC
CAGGGCGTGAGTGGCGAGAATTCAGGTTACCACGACGACGGCCGCCTCTGACTACTCACGACGTGTGGGCACGCCGGATTGGAAACCTGGTGCCCACTGT
AACGAGGTCTTGACGGGGACAGCCGACAATGGTGCGACTAACGAACGTGTCACCGAAGATTGCTCACTGCGCGAGACACGAATCGGTACTGCTGTGGGTG
AAAAAGGGTGACCTGCCGCAAGGAGATGGATACACTCGTTTGAACTCCGCTAAGTATGAGGAGTGGCAAGTCCTGGCGTACGCAGAGTGTCGAGACGAGA
CCTTGTTCGCGCGGGAACGCAAACTCTACGAACGATGGTTGGCAGATCAGCCACCAGCTGTAGAACGACGAGACTATTCGACACCTAGCGGCATCCTACC
TCGACCATCCGACGACGTGGGAGGCCGAAACGAGGGCCAGATAACGTTCGCGGATAGGAGCACTGAGGAACCGACAGAACGAGACCGAATGCCGTTGACG
ACTTCGGTGCAACCCTCTGACGAACCCGTTGGAGATAGATGGGTCGACGAAGATGACGACTCGGTGGCGACCGACACCTCTGATGGCGCGGATACCACGT
ATACGAGTGAAGAAATCTCCATCCCAGTCCTCGGTGATGACCCGGAGACCCGATTGGACTCTGCCTTCGTAGCAATGATGCATGAGATTACCGCGGGGGA
CGGTTCAGGTAGTGGGAACACCGATACCAATACGTCCGAACATTTAGCGAATGAGATCGAGTTGACGGCCTATGCACACGAGTTGGCGTTCTTACCGGAC
CTGACCGAAGCCTCGGAAACGGTACTGGATTATTCAGGACCGAATGTTCTGAACCCGAGCGCGACAGCCCGTCAACAAGAAAGTCTCGTTGCGGTGCTGA
AACGACACGAGAAGATCATGATTGCGAGTGGGAATGCTCTGCCACCACCGGCCTACGGCGTGGTGTGCGATATTGACGTACAGGGGCATCCACCCATCAA
ACAGAGAGCTCGGAGAACACCGCTCCGACACCTTCGGAAGCTGTACGAGCTTCTGAAAGGCTTGCTGAAAGCTCGTCTAGTGGCGTTTTCGGACAGCCCA
TGGGCGTCGCCCATCGTGATCGTGCTCAAGAAGAATGGAGTTGATATTCGGTTGTGCATCGACTACAAGCTGGTGAATGCAGTGACGGCGATTATGGAGT
ATGCCATGCCGTTAGTCGACGACTTGCTGACCGACCTGGAAGCCTACCTATGGTTCTGCTCACTTGATGCGGCCAGTGGATTCTGGGCTATTATGATGAC
GATGCGGGCCCGCAAAGTCTCGGCATTCGTCTGTGCTCTCGGACATTTCGAATGGCTTCGTATGCCGTTTGGATTGAAGAATGCACCGATGATTTACCAA
CGAATGATTGACAATGCTCTGTGGGGTTTCGTTCAACCCAAAGGCGGCTGGCTCCACTTTTCGGAGCTTATGCGAACGGCCGAAGCCCACGCCGAGGTTG
CGCGGACAGGGGTGACCGACCCTTCATCGCGACAACTTGAGGAGTCAACAACTCGGGTGACCAAATTCGAGGCCGACCGCGAATCCTCGGTCACGCTTGA
CGCAGTGAATGGGTTAGTGAACAGCCCTGTTGCCGACATGTTCTCCACCGGAGAACCGGATGAATCCTCGTTGGTGCCAGTGTTCGACCGACGGTCGTTT
GTCGATGATATCTGTTTTGGGTCCGAGACTTTCGACGCGTGCCTGGAGACGTTAGACCGTCTGCTCCAACGGTTCACCGAATGTCGCATTAGTGTGAGCT
TTACGAAGAGTATCTTCGTCCAGCCAAAGGTGGATTTCCTGTCACACGAAGTCTCTGCAGAAGGTATTCGAGCCGACACCAAGAAGATGAAAGCAGTGAC
CGAGCTGCCATTCCCTGCTTCAAAAAAGGGGATGCAGTCTTTCCTCGGTGCGCTGAATTATTACAGTCGATTCATCCAGGACTTCGCAGTGTATGGAGCA
GCTTTGTACCAGTTGAAGGACGAAGACTTCACGCCTAGTGGCAGCCTCTCGGCAGCCAAACGAAGCTTCGCCGCGCTCCAACAGAAGGTTGCAGAGGCAC
CGATCCTCCGGCACTTTGACCGGGACAAGGAGGTGCATGTCACGTTATTCGCGAATGAGTGGGCATTGAGCTCCACTTTGATGCAATACCATGATGACAA
ATTGCACCCGGTTCGATTTTGTGGCCGAGTCCTCAAGGACGCCGAGATGAACTACCACCCGGCCGAGAAGGAGGTCTTAGCGCTACTGCTGGTGTTGAAA
ATGTGCTACTCCCAGTTGGTGGGTCGGACCATCCACGTCTATACGCGTTTTTCGACGCTCGAATGGGTGCACAAATCTAAGACACTGTTCGGTCGAGCGA
CCCACTTTGCGGTTATGTTGTCCCCGTGGCACCTGGTGGTCAACCGAGTCAAGGAACGCGATTGCACGTTTGCTCAGCTTCTCCAAGCTGGCCTCACAAG
CTTCGTGGAATTGGAAGAGTCGTTGGCCCCGGTTACACCGCCGACGAAAGGGTCACCCACTGCTCGTATGGACCCCCACTTGCTTTATGCCTGCCTACCG
AGGTCCTATACCGGATTTGTGATGTCGTTCGATGGTTCGGCCAAGACCGAAAAGAACGGTGGATACGGCAGTTGCTCGAGGATTTTGTGAAAATTACCAG
AATGGACTGTAGTGACGGCTGCGAGTGCTTATCTCGAGACCACCACGGTAAACCTCGCTGAGTATGCTGGAATGAACAACGGCGTCTCAGCTGCGCTCGA
ACATGGAGCCGAGGATTTAGTCATCGTGGGAGACTCGAGACTCGCAATCCAGCAGTCCCTAGGGGTGATGGCATGTCGAAAGGAGTCTCTGATGGTTCAA
CTGAATCGTCACCGAGAACTCACGACCAAGCTGCGGTCGGTGAAGTACTTGCACGTGGTCCGAGAATTCAACGCTGCAGCAGATTCGTTGGCAAGCGAGG
CTCTCAGCAGCAAAGAATCCAGCGTAGCTTCGACCGAGGCTAGGAAATTAGAATTGGTCGAGCTGAACCGGATCGGAGAGGTCATCTATGAACCCTCAGT
ACAGACCACGGCCGAAGAGAAACCGACAGTCAGCTTCGCCCGAGCCAAGTAGCCCGTGGAATCTCCCGCGACAGATCTTTTTTCGACTTTGTGCGGGACG
AACCCGACTACCCAACTGCAACAACCAGACACCAAGCAAAAGCGAGGAAGAAACGAGTCCAGTTTGCAGAGGAAACGTCGGTGATAGAGCCGAATGGTAC
GGCTGAGCGAGACGAAGCGAATGGTGTGATCACCGAAGCTCAGAGTGAGCTGAGAGCCGAGCAATCGAGCAACGAGGTAGACCCTGGCGCTCCAAACGCA
GAAGACGTTGACCCTGTGGTTATACAGGAAGAGCGCCGGAGACGAATCTCCGCCGCCCAGGACGAAGAGCTGAGATGGTCGAACCTAAAAGCGGTCCTCC
GAGGCAAGGAAACAGACCTAAGCTACAGAGCAGCCAGAGACGCTTGGAAGATGGCCGACAAGTTCGTGCTTAGCGAGGGTGGTGTACTGTATTTTCTTGG
AACGAACCGTCGGTGGGGCAACGAACGCCGAGAGGAGACAACGATGCGTCTAGTGGTGCCCACAACGATGATTCAGGAAGTACTACGGAGTTGCCACGAC
TCGTTGGGAGGTGGCCACCAAGGTATCGGTCGAACGTACCACCGAGTCAAATCAGACTATTTTTGGATTGGACTATATGCAGACGCCGAACGACACGTCA
AGTCCTGCTCCGACTGTAGTTCGAGCAAAAGTCGACCACAGTTCCGAGGCTATTCGCCAGGAAATGTCTTAGCAGAGCGACCGTTCCAGATGGTGTCGAT
GGATTTCGTCATACCGTTACCGAAGTCTCGTCGGGGCAACTCAGCCCTACTACTGTTCCAGTGCGCGTTCACAGGATTCGTCATGGGTAAAGCTATGTCA
GACACTACCGCCCTGAGGGTCGCACAGGCTTTCGAGGAATGCGTGTACCGAAGATTCGGAGCACCAACTCTGATCCGACATGACCGAGACCCTCGCTTCA
TGAGCGAGGTGTTCCAGGCCTTTGCAGAAATGATGCAGTCTCGGTCAAGAGCAACCCTGAGCTATCGGCCGCAGGCGAACGGACAGCAAGAGAGGTCGGT
GAAGACGGTCATGCAATCGGTGCGGGTGTACGCAGAAGACCCGCTACAGCAAGACTGGGA