Description :
From Genome Similarity Track
Location :
Scaffold_3983:1- 1677
Sequence
1676 bases(100 bases per row)
CACCTGAAGCCGAATGAGCTGAACTACGGAGCGGTGGAGTTAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACTACCTGCTAGTGGGAAGAC
CCATCCGGATCCTGACTCGACACTCCACACTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGTAGCTTTACTCTCGCCTAG
GACGCTGGAGATTGTGAAGTGTTCGAAAGGAGAAGACGAGATCCTGGGAGTCTTGGCCGCGCGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACT
AGGATCACCCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGTGGATGAGGATCTATACGTCCTGAGTTTCGATGGATCCG
CTCGTGTACGACGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGACTGCCCGGATGGGAAGTTGTACGAGCCCGATCCACTTACGCAGAAGGCCTCAC
CGTCAATGAGGCGGAGTATAACGGGCTCCTTCTGGGTTAGGATTTACTAAAGGGACAAGATCCAAAAAGGCTGGTGATTTGTGGGGATTCGAATTTGGTA
ATCAGACAGGTGCGAGGCGAGATCGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGATGGTTGAATCACGAGT
TGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGACAGCTTGGCCAGTGCCGCTTTACGGAATCAATGTGGTGTCGAAGTGGAGAGAGAAGCCGGGCA
TCAGGATCTCGTTACATTGAACCGACTAGACGAAGTGGTGGTAGTTGGATCCAGGAAAAGAACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGG
ATTGGATCCAGCCCCCAGATCCTCGAGGAAATATTTGTGAAGGGAGCCCGTATTGAGCGGATCCTCAAAGCACAAAACGAGGAAGCGTGGATCTTGGGAC
TAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATACCAAATCCTACAGTATTATCGCTACGGATTACGCAGTGGATCTGAATGACTT
GCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGACCGGGATGGATTGATGAGACTGGTGATGCCAGAAACCTTGCAACAGGATGTCCTACACCAC
TACCATGCTAGCCTGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCACTGAAGAGGACTATTCAAGAGCGTACAAC
GATACGTCGGTGAATGCGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAATCGAAGAAGAGTCACCTGGAAATATCCAAGCGACTTACCCTTTCCAAAT
CATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGGAAACACAGAACTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGGTAGCCAAA
GCTAGTGCGTCTAGAACTGCGCAGACCATTGCTGAATCGTACGAGGAGTGCGTTTTTCGAAGATTTAGGGCTAGTGAGCTGATTCGGCATGATCCGGAGC
CAGGCTTTATGTCTGATTTCTTTCGATCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGCATATCG