Description :
From Genome Similarity Track
Location :
Scaffold_176:1- 1672
Sequence
1671 bases(100 bases per row)
AATGTCGTCGCGGACGCGTTGTCGCGCCGACCCGATTTTGAGTCGGCTACGTAGTCCAACAGTGGGGTTAAAACTACTGTTGCAACACTAGTCACTAGTG
TCCCGTCGTCAACATTGCTTGATGACATAAAAAAGGCCTAAGCAGAAGATAAGATTCTTCTGCGACTAATGGATCATCCAGTGACTCCTCTCGTAAATCT
CTTAAAGATTTACCAGCCTTGTATCGATTGTCCGTGGATCGATACACAACACGCAACGGGTTGCTGTATTATACAGCCGTTACAGGCGACACACCTTGTG
TCGTCGTCCTCACTCATAATGATTTGCTCTTACGCATCATGTATGAGTGTCACGATGCACCAACTAGTGGGCATCGTGGGCGTGAGAAGACTTATCTCAC
GGTAAGTCGCGACTTTTACTGGCCCCGCCAGTATCAGTTTGTGCGCAAGTACATTCGTGCTTGTGAATTGTGCCAACGGGTGAAGCCCAGTCCTTCATTC
CGTGCGCCACTACAGCCTCTACCAATCCCGGCTGAGTGCTGGCAGTCCGTTTCAATGGACTTCGTCTTCGGTTTCCCCGAAGATGCTCACAAGAATAATG
GTATTCTTGTGTTCGTAGACCGATTCAGCAAGATGGCACATCTTGCTGCAGTAATGAGTCAATCTCAGCACAGTTGTACCCTTGTATTCATTGACACGGT
ATTTCCACTCCACGGTCTACCCCGTGAACTAGTCTCTGAGAGATCCTCAGTTCACGGCAACGTTTTGGCAATCCGTGTTCCGATCTCTCGAAACACGTCT
AACTATGTCTACTTCTGACCATCCCGAGACTGGTCGTCAAACAGAACGCGTCAACCGCGTTCTCGAAGAGATAATTAGAGGATACGTCCAATCTTTCACA
GATTGGAGGGAATTTTCGCTGGTGGAAGAGTTTTCATCCAACAACTCCGTGCATGCATCGACAACATATACACCATTCTTCGTGAATGGCTTGAGCCATC
CACGCCTACCCTCCCATTTAGAGTGTGACACTAATTCAAGGGGGTAGGGATTCGCTCAAGCAAAAACAGTTCTGGCTCTTGCTCATCACGTGTCGAGGTA
ATCGACGACGTGGACGTTGCCGATGTCGATCAAGTCGACATCGAAGAAGATAACCTTATCAATAGTGACGACACTACTGCTGACACAGATGAGGATGACG
ATGCTGGTATATTTAGCATCGCTAATGACTACATTAGCGAGGATGAGAACACCGTCGCTGATAAAGATGATGGCCTCCTAGCGATACGCACATGGCGCAC
TGCAACAAACCAAAGTGATGCAGCAGAAGATTTCTGCTGGCACGAGAAGCAGTGGTCCGTTTCGTGCAAGACTTTATTGCTAACGTGGTGGACCGGCAGA
AACGGAACGCTGAAAAACATGGAAGAGCAAACGTTCTTCTATTTAATGTCGGAGACTTAGTTATACTGTCTACGGTAAATCTACCTAAGAAAGTAGTAAC
CGATGTGGGTAGTACTAAACTACTACCCAAGTACATCGGCCAGTTCCGTATACTAAGTCGCAAAGGCAATGCGTACACAGTCGGGTTGCCTCGCAGGATG
CGTACGCATCTTATGTTTTATGTCGGTCGTCTCCGCCCGTACCATCACCACGAGGTCTCTTTTTCGGGTGA