Description :
From Genome Similarity Track
Location :
Scaffold_3999:1- 1649
Sequence
1647 bases(100 bases per row)
CATGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACATGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGATTCATC
CGATCTGCGGCAAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTTGGTCTGGAAGCTGCGCAGCAAATCCGGCCACTTGTTCCTG
GTGGATCTGCCCAGCTACCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGACGCTTGATCTCTCATGA
GGGCCGACTTGACTTTGATGAAATTTGGTGGAAACCCGGTTTTTCCCCTCGGCTCCTCCCTCTTGTAATCTTCTGCCGCGGGAAAATCTCTCCCGGTCCG
CAAAGTGGTGTGAGAAACCTCAACTCTCGCGGAAATGGGTAGAAACACCCCTGCCCCGCGCCTGTGGGTTGGTTGGTTCACCACGCCCGCCAAAACAGGA
AGGTCCATCCAAATATTGGGTCCAAGCATCAGGAATTGTCGCTCCATGATCCATTCCACTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCAC
GGGCGCTCTCATATCCTGTTCGGCCAGGAAACGACTCATCGCAGCTTCGAAGTACCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTC
TGGTCCACTGGCGAGACAGGGTCCGTGAGGCGATTACCTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGATGG
ATTGTGTCAGATCACGCGTAGGGCCTACTGGATCCCGAGCCTTCACGTTCACAGGGGCTTCCTGTCTTCGGACCCTCGCCCGCGCTTCCAGCATGGATGC
CCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACGCATCCTCAGCGGCGGATTCGTAGTTTGAGGACGCAGCTTGGCTGATCCTC
GGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTA
GCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGACTGCCACCAACTTGTTCGCCGTTTT
TCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATATACATGACAGGATCTTGATGCAGGAAATCGCGTAGAGCTTGGTG
GCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTA
CTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCT
TCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATC
CGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAAC