Description :
From Genome Similarity Track
Location :
Scaffold_132:1- 1648
Transcript NameFunction/comments
Phyin_T30-4PITG_200472-isopropylmalate synthase%2C putative

Sequence
1647 bases(100 bases per row)
CGCATTTTGGTTTTTGGAGCTCACCAGCCCAAGTGACCTGCACTCTCGTTCACCATCATTAGCCCAGTCCATAGTTGCAGCATGATGCAGACGATCGCTA
AGCGCTCGGCCACCGCAGCCAAGGCCAACGCGCGTCGCGCCTTCTCGAACGCCGCCGCCGCCGAGGCTGGCAAGGAGCGCCTCGTGCTCTTCGACACGAC
GCTGCGCGACGGGGAACAGTCACCCGGCGCTACGCTTAACTTCAAAGAGAAGCTGGACATCGCTCGTGCTTTGAGCACGCTGGGCGTGGACGTGTGCGAG
GCTGGATTCCCCATCTCGTCTCCGGGTGACTTTGACGCCGTGTCAGCCATTGCCAAGGAGATTGGCCCCATCACAGCCGGCCGTCCTACGGGCGAGCCCA
TGACTATCTGTGGTCTTGCTCGCGCTATGGAGAAAGACATTCAGCGCTGCTACGACGCTGTTAAACACGCGCCCAAGCACCGCATTCACACATTCCTGGC
CACGTCCGACATTCACCTCCAGTACAAGCTTAAGATCTCGCGTGATGAGTGCATTCGTCGTGCTGTGGACGCCGTTAAATTCGCCAAGAGCCTGACGCCG
GATGTTGAATTCTCCACGGAGGATGCTGGACGCAGTGACCCCGATTTCCTATGCGATGTCCTCGCTGAGGTCATTATGGCCGGCGCCACCACGCTTACAT
CCCCGACACTGTCGGCTACACGGTCCCAGGCGAATACGGGTCGCTTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN