Description :
From Genome Similarity Track
Location :
Scaffold_3998:1- 1647
Sequence
1646 bases(100 bases per row)
CGAGGAGTAAGGCTGCCCCACTGTCCCAATCGTCCTGGTAAACCGGCCGACTTGAACAACCAAGCTAGCGTAAAGTGTCGAGTCAGGATCCGGATGGATC
TTCCCACCAGCAGGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATTTCCTTCTCCACCGCTCCGTAGCTCAGTTCGTTCGGCTTCAGTGTCC
GGCTGACGAAGGTGACTGGATGATAGATCCCCTCATGTTCTTGTACCAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACG
TTCTGGATCAAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCC
ATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACCAC
TTGGATTCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCCTCGCAGCAAAATCTACCTCTCTCAA
TTCATACAATACTGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGTGGG
AAGGACAAGTCGGCTAACGAAGACAGGTCCTTAGGATTTGCCTCCAATCCCTCCTTGGAGACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAAT
AGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTTCGCCGGGATTAG
AATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTTCCAGGATCCCCTGGCTCTCCTGCCTCAAATGAATCTACTTCCGTATGATCTTCCCCG
GATCCACCACTTTTGGGTTCCGGTATTCGGGTGAATCCATAGAGAGCGTTATCGATTAGACGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCA
TCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCACTCCGTCATAGTAACTACCCAAAAACCGCTGACCATGTCAAG
AGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAGCAGCTCATTGATTAGAGGCATCGGATACACCATCAATCGAATCAGACCGTTAACCAGCCGGTAA
TCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCA
GGCCCTTAATCAGATCCGATAGTTTTTCTCGGAGCTGAGGCGCCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTT
GACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGTTCAT
TCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCATCTGT