Description :
From Genome Similarity Track
Location :
Scaffold_192:1- 1634
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap_masked-piw_contig_192-abinit-gene-0.24Transcription factor

Sequence
1633 bases(100 bases per row)
GCTCACGTGCTGCAAGCCAAGGCGCTCGGCGCAGTCGTGGGCGAGCAGACGCTCAAAGCCGTTGAGGTTGGCGTCCAGGTGGATCATCTCCGTGGTGCCG
GCCTCGGCATACGCTTCGATGCGCTTGACGAGCGAGTGGGAACTGCCCGACGAGATGCCCGGGTTCACGTTGCCGCTGTAGCTCACCTTTGGCGCCGGCG
CTGGGGCTCGCTTAGCAGCCACAGCAGGAGCAGCTGGGGTCTTTACGACGGGCTTGGCGGCGACGGCTGGCTCGTCATCATCGGACGACGAGGCCTCGTC
ACTGGACGAGCTGGTAGGCTTAGCCACTGGCGCGCTCTTGGGCTGGACGTCGTCGTCGTCGGAAGAGGCCTCCGAATCGGACGACACTGCGTGCGGTTTC
GCAGCACTCGTGGCAACAACAGGCTTGGCAGCTGCAACTGGGGCCTTGCGCACCACAGGCGCGGCCAGCACAACCGGTCGCTCGTCGTCGTCGTCGCTGG
ACTCGGAGCTAATGTCGCCACTCTTAACCACTGGTGCTGGAGCTACTGGCTTGGCGACCGCGACCTGCTTCTTCTGGGCAACATCAGCAGCGTTCGTGAC
GGACTGGGGCGGGAACGCGAGCACGACGACCGGCGGCTCGTCCTCATCATCCGAGTCCATCGTTTCGTCCTTCTGCTCCTCTTCCTGTTGCATCTCAGGC
TCGGCCTCGTCGTCCGAGGACTCGGACTCAGACTCGCTCGTGAGGTCGTACTTCGGCACACTCTCAATGTACGAGATCTCAGGCACCACGGGGGCTGGAG
CCTTGGCCACCTTCTGCTTCTTCAGCACAGGTTCCTGGACCATCACTGCGGGCTTTGCAGCCACTGGTCCACTGGACGCAAGGAGCTCCGTGCGCACGTG
GCTGCGCAGACTCTTGAACTTGTGCACCGAGGCATCGCACGCGGGACAGAGCACAACCTCGCACTGCGCACACATGACGCTCGACTCGCTCTCCTCGCAC
TCGTCGCACACTGGGTTCTTCTTCTCCTCAACTACTGGAACAGGCGCGAGCTTGACGCGCTCGTGGGACTTCATGACCTTGGACTTGTGCACGAGTGCGT
CGCAGGCGTCGCAGTAGAGCGAGTCGTCGCACTTGGCGCACTGCCACGACGCCACGTCGAGCTCTTCGCACTCGATGCATGTGCGGTCCAGGCTCGCGCT
CGACGCGACAGCGGCTGCTGGGGTCTTCTTCGCAACAGCATTGACAGCAACAGGCTTGAGGGCCTTCTCCTTCTTCTCCTTCTTGGCAACCGGCTGCGCA
GGAGTCGGCAGGTCGTGGCTATACGTGCACTGCTCGCCGCGCTTGCAGAGCCCGCTGAAAAAGAACTGGCATGGACGCTTCGCAGCCACTGCTGGCTCAG
ATGCCTTTCGCTTGAGCGCCTGCGGAGCCGCCTGTCCATCGACTGGCGCTTGTGGAACCGCGCTACCGTCGCCGCGGATATGCGCAAAGCGGCACGTGGC
ACCGATGGAGCAGTGACCGCGCGCAAAGTGGCGACACACGAGGCTTCCTGGCAGCTTCGCGATCTCCGAGGCGGTCGCAGCATCGAGAGATAAAGGAACT
GCGGTTAACTGGCGAGGCGCCTTCGGGGTCTTT