Description :
From Genome Similarity Track
Location :
Scaffold_2083:1- 1632
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_2083-snap-gene-0.0Polyprotein

Sequence
1631 bases(100 bases per row)
GATTATGATCCGCGTTCTGCAACCGGTCCCTTGATCGATGTTGATGACGACCAAGATGAAGACTGCAACATGTGTGCAGCCGCGGGTCTCAACACAACGG
CGACAACGCCCGTGATACCGTTGCGAAACCAACTCGCCGAAGCGTACACCGAAGATCCCTTCTACGCTGCGATCATCAAGCATCTGCGCGCTCCCTCGGA
CGACACTCTTGCGGCACTGTCGCGTCCAACGCGCACGCACGTCGAGCGTTACGCACTCGACGGTGATCTCCTCACCTATCGCGCCGATGTCTTCGACCCA
CCGCGGGTTGTTGTTCCGAATGATGCCGATCTCCGTGCTCGTGTGGTTCACGAGTACCACGATGCTCCGACTGGCGGACACTTGGGCCGCGAGAAGACCG
CCGCAGCTCTCTCGCGCCATTACTTCTGGCCCCACATGTACAAGTGGGTTCGCAAATGGGTGCGAACATGCGAGATCTGCCAGCGTGTGAAGCCGTCGGC
GTCGTCGCAAGCGCCGCTCAGTCCCTTGCCAATCGCGACCGAGGCATGGCGCTCGGTGAGCATGGACTTTGTCTTCGGCCTTCCACGCGACTCCAAAGGA
AACACCGGCATCGTGGTCTTCGTCGACCGGTTCAGCAAGATGGTGCATCTTGCTCCTGTGACGCCAAACGTCACTGCGGAAGAGACCGCAGCGATCTTCC
TGGACATCGTCTTCCGACATCACGGACTGCCGGAATCAATCGTCTCTGACCGCGACCCGAGGTTCACCTCGGCGTTCTGGACACGTCTCTTCGAGCTCAT
GGGGACCCGCCTCATGATGTCGACGGCGGCTCACCCCGAGACGGACGGTCAGACGGAGCGCGTCAACCGCGTGGTCGAAGACGTCCTTCGCAGCTATGCG
ACGTCTTACTCGGAATGGTCCGAGTTCCTCCCGCTCGCCGAGTTCGCGCTGAACAACGCGATCCACGCGTCGTCCGGGTTGACGCCGTTCTTCGTGAACA
ACGCGCGTCACCCGCGCGTTCCCGCAATGCTTGCCGTGGGAGCCCCCACGGCGCAACCTGTCTCCACTCTTGGTGGGGGAGGAACGCATGCGACAGTGCC
ACCAACGGGCGTCCCCCTGTCGGCATGTCCAGTTCAGAATGAAGACGACAGTTCCGGGTTCCAACACGAGTCAGGCGGGCCGAGTAACCCGCTCGGCCCG
GATCACGGCGTTGGCCCACCTGCCACGCCGAGTCCATCACCAGCGATCAACGCAACAGCCGTTAACCCGCGGTCAAGGCCGCACACCACAACATCAAATG
CTCTCTCGCGTTGGGCGTCGCGAGAGTTGATCGACCCAGCGCACACAGTCGCGGTGCGCGGCGGCGCGGCGTTTCCCGCCGCGCCATTGATGGCGAATTT
CGATCCCAAGCCTGCAGTGCTCCCGAGCGACGCTCGGGCGGCGTCAGACTTCGTGCTACAGCGCCAAGCCATCGTGAGATTCGTCCGCGACGCGCTTCAA
GCGGCCGCGGACAAGCAGAAAGAGAACGCAGATCGGCGCGGGCGCCGAAACACTGCAACGTTCAAGGTCGGCGACCGAGTGCTGCTGTCGACTGAAGGCA
TCCGTCCCTCAGCTGTGACGAACTTAGGCGC