Description :
From Genome Similarity Track
Location :
Scaffold_3384:1- 1631
Sequence
1630 bases(100 bases per row)
GAGAGGATACAATGGCTGCGAAGCATGCCGTACCCGACCAATGCAGGAGAGTTGCAGCAATTCCTCTGTTCCACAAATTGGATGAGAGACAGCATCGTAG
ACTATGCTCGATTGGCACGTCCACTGAAAGACACACTGGACCAGGCGATGACCAAAGCGTCGAGATGGACGAAGCGCGTGGCTTCGGGAATTCCTGTGGT
ACTCACCGCGCAAGAACGCGCGGCGTACGACAAAGTCAAAGAGGCTCTAGCTGATGGAGCTCCCAAAGCCAGACGCCGAGATGATTTTGCTGACTGATGC
CTCAGACGTTTGTGGTCCGTCATTGTTACCCAAGTGCCGACTTGGAAAAACAGTGCGGATATacaagaccagcagcacgagctgttAATTTGTCTGGGTG
GTACATTTACGGGTGCGCAGAAGAATTGGAGCGTTATCGAAAAGGAAGCCTACTCGATCATCACGGCGTGTGACAAATTGAGTTACCTGTTGTTACGTCC
TGGTGGGTTTCGCATGTACTGCGACCATCGCAACTTGATACATGTTTTCGCGCCGGGGCGTGAAGTAAAAAAACACGTGCTTGGAAAACTGCTTCGCTGG
GCCATGAAGTTGATGGAGTATCGGTACTCTATCGAGCACATTGATGGCATTCACAACGTTTGGGCTGATATGGTTTCTCGATGGGCAGGAGCTCACCCAG
CACACCTAGTGTGACTGTCAAGCGTGTTGTATTGAAGCGACATCATGAAGATCAACAGACTAGTACCCAACAAAGTTCGCCACCGGGTCAGACCTCTCTT
CGACCATTTAGTGATGGCAATTTCGTATGGCCAACAGTGGAAGAATTGCAGGCAGCTCAACGCAAGGGTATTGTGGATCGACCACAAGGGTTGAAGCCTA
GTCGTGCAGATTTGTTGTGCAGCAACGATCGAATTTGGATACCAGCTACCGACTCTGACTTGCTTCAGCGGTTTTGGTGATAGCTCACTGTGGACCCCAG
GGTCACAGAGACCGTGAAGCGCTGATGAACGTGGTCAATCGCAGGTTCCTCGTACGGAATCTATCTGGCATAGTCAAGAAATTTCTTGCTGACTGCCTCA
TGTGTCAGCATGTAAAAGGGGCAAGGTGGTTAGTCGACCATGGGCAGATACACTCCGAAGTCCAGATCGAAATGGAGGATTGCACTGGGACTACTTGCAC
CTCGGTGACTCATACGGCACCTTCAAGTATCTGTTGGTACTCAAAGACAACGTGACCCATTTTTGTGAACTTGTGCCGTGCGCAATACCAAATGCAACTG
CGACTACCGAGGCCATCCTTGACTGGCACAGTCGCTACGGTGCACCTCGCATGTGGATAAGTGACCAAGGTAGCCATTTCAATAACCGAGTCGTGACTGA
AGTCGCTAGGAGCCTCGGGTGTGAGCAACGGTTCACGTTGGCCTATAGTCCATGGATTAATGGAACAATCGAGCGATTGAACCGGGACATCATCCAAGTC
TTTCGAGCATTGTGCCTTGAAAGCAAGGTGGACATTCGTGATTGGCCGCAGTTCATCCCAGTGGTCCAGTCAAGTCTGAACCATACTCCTGTTCCGTCAC
TAGGAAACAAGGCGCCGGTGGGGCTTTTCT