Description :
From Genome Similarity Track
Location :
Scaffold_3564:1- 1607
Sequence
1605 bases(100 bases per row)
CAGAGCGCTGAGTTCGCCGCtctgaagcaggagctgagccTTCAGAAGGCTCAGGCCGCGGCAGTATCGCAGACTGCATCGAACTTGAGCGTCGAGCTAG
GGATGAAGCTCGCGAggttgatgaagcaggtCGCTTCGCTCGAGAAATGGGTCGcccctgcttcttcttcttctgcttcggcgGGTCATCAATACTAGGt
gactcgtgctgcacgtgcggCTTCAGCCACCGACGTAAAACGTCGGATGGAGGCGCACCCCGGTCGGTATGTCCAACGTGTAGGCGTTGCCGTGCCGCTA
GAGCACGGTGAAGGGCCCGATGAATCGAGAAGTAAGCTTGGTTGCTCCGAAGTCAGAGACTGCATGTTTAGCTAGGTTTGTGTACATAACAGAACCAATG
AACCCTTCTTGAATTCAATGGTATTGCCTCTGCCGACATTATCAGCCTTCAGCTACTGCCGATCATCAGAAGCTACAATAGCATCCTGGACAACCCGAAT
GACGGCTTGCCTGCGCTGGACAAAGTCCATTGCTTCCGCGCTGAATGACTTGTTCAGTTCGACTACGTAGGCCTGGCCTGTGCGTGTCCGTGTTCGGTGT
CTGCGCACTGCACAGACACGTGGTTGTTGTTCTTCGCTACAGGCCCTGTCTGTGAGTGTATGTGCTTTAATACAAGCCCAGTTTGTGCGTGATTCTTTGC
GGTGTCTGTGCTCGGCACAAACACGGTGTTCTAGTCCGGCGTCACAACTGATACTGTGGTCGTATCAGTTGTTTTCTGTGGTTGCAGGTTTGCAGCCGTA
GATCTTTTCCACTTAAAGAGGAAGCCACCGACCCAAGCATGTTCGGTAGGCGTGGAAGCCGCATGACATTCACGTAGAATGGTGTATGTCCAGGCGAAAC
AGGTACcgagttgttgatggcgaactcTGCCAACGGcaagcagtcgctccagtAAATAAANCTCGATCTGCCCGTCCGTCTGCGGATGATCCGCAGTCGA
CATCTACAGCTGTGTTTCAAGAAGTGAGAACACTTCTTGCCAGAACCATGCTGTGAAGCGTGGATCACGATCCGACACGATATTGTGTGGCGTGCTATGG
TGTTTGAACACCCTGTCCACGAGCAGATGTGTTGTCTGCACGGCTGTTACCTCAGCCGGCACAGCAGGAAGACCTCTGTACCAGTCCTTCACTTGCCATC
CGGCGGAAGACCGAAAAAGCAGTCCATCGAGATGGACTTCCAAAACTCCGACGTTGTCGGGAGTGAGCCTGCGAAAATGGAGCAGGCTTCACGAGCTGGA
ATACTTCGCAAGCACGAATGTACTTGCGCACTCATTTGTACTGGTGCGTCCAGTATATATCTCGCGTGAGAAGAACGCAAATCTTCTCACGACCCGGATG
TCCTGCCGTAGGGGCCTCGTGGTATTCGTACATGATCCTGAGTTTCAGGTCATGGTTGTCAGGCACGTCAATGCGATCAGCGTTGTCGCCGACTGCGCTG
TATAGCAGCAAGCCGTCGTGCACTCGATAACGGTTTCCACGAGCGCGTAGGTGGCGGGACAGCTTCTGACGAGCTCTGtcagaaggtgctgacaCGTAGT
CGAGC