Description :
From Genome Similarity Track
Location :
Scaffold_5432:1- 1602
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_5432-fgenesh-gene-0.0Chromodomain-helicase-DNA-binding protein

Sequence
1601 bases(100 bases per row)
ACGAAGGGGATTGCAGCCGTGAGATCAAATCCATTGACAAGGCATACGGTACGCCCGCATTCAGACATCTTCGCATGGTTGAGCAGGTCAAAGCGCAACT
GTTTGCGTTCCACTGTCTGCTGAACAACCACACGCCCGACAAAGAGGTGTTGAAGCAGTGCGGCGTGTACACGAACGCGTACGTGTGCAAAAAACAGTAT
CTCCATGCCTCCCTGAAGCAGGCCCATCGTGTTGGTGACAACGAAGATGAAGACTATTCGGAAGATGACGGCTCGGAATCGGAAGACGACGACTATGATG
ACGAGATGGAAGAAGATTTGCCGTATCGATTTCGCCGGCCGGCTCCTGTTTCGTTGTATACCGACATCATCCAGGGCGGGATGGAGGAAGGCGATGGCGA
CGACGATGATTCGGTTGGAAAGAAGAAGCCCGAGGATGAAGTGAGCGATGTGCTTGGCGCGCTCGTGGAGCATGTCGCGCTCGGTTATCCGACGACGTTG
GAGAAGGTCGTGCAAAAGACCACGTACAACTCGAAGTACCCCGTGACTTCGTTCCAGGGGATGGACGGCTTCACGGAGTATTGCGTCGCACTTCCAAAAA
CAAGCCTTGGTCTTGGTATGCGCTTGGGCTCGAACGAAGACGGAGCGTCGGTGGTGCTCGGCTTCCAGCGTCTCACCAATGGGATGGTTGGTCCAGCCGA
GTCGTCCCAGGTGATCACCACAGGCGATGTGCTTGCGGCTGTGAACAACGTCTCGGTTGCGTCACGAAGTTTCAAGGAAGCGATTGCGCTAATCGCTCAG
TCGCCTGAGTTCGTTCTTTTCCACTTTCACTCCAAGCGGCTTGCAAACATCTATCCGGATTATTGCCAGGCAAAGGTTGTGAAGATGCGACGAGAACCCG
TCTTTGACAACGCAGCCGAACCGTCCGCCTTCATCCCGTACAGCTACAACGCGTTCAAGTCGCCCATGCGCGTGGGCACGGGTGCCGTCTCAACCATGAC
TTCCCACACGATCGCGAACGCCAATTTCCTGACTCCAACGGGACCGATGCAGCACTTGTACGCGGGCATCGTCGACAACAGCATCGACCCGCATGAGCAT
TTTGCGAGCTTCTTACCGGCCGATCGCTCAAGTGCAAAGCAAACGGCAAAGAAGACGACGGCCGACAAGAACGACTTTGTCCCGTACGAACATTCACCGA
CGTTCAAGGGAGGTCGCACGCTACGATCGTACCAAGTCGATGGTTTGAATTGGATGGTGACGAATTGGAAGCAGCAACGCTCGTGCATTTTGGCCGACGA
AATGGGCCTCGGCAAAACGGTCCAAGTGGTCTCATTTATTGACCACTTGCGGTCAGAAGAATCTATTCGAGGGCCATTCCTGATTGTTGTGCCGCTCTCC
ACGATCCAGCACTGGCGCCGTGAAATCGAGAGCTGGACGGATTTGAATGTGTGCGTGTACCACGACATTGGGGATCATCGCGGCAACAAGTTTACGGCCA
AGGACATGCGCGCGGTCATCCGCAATCAAGAATGGTACTACCCGGGCCTGCCGAATTCGATCTTCAAGTTCAACGTACTGCTCACGACATTCGAAACGAT
C