Description :
From Genome Similarity Track
Location :
Scaffold_3523:1- 1601
Transcript NameFunction/comments
Phypl_g15878pol protein

Sequence
1600 bases(100 bases per row)
GACATCTTCGTGCACAGCCGTGCTGCGGAAGGTAAAACGGCTGATGAAGTGCATATTGCACACCTCAGGGAGGTCTTGCAATGCATGCGGGAAAATCGGC
TGTTCGCCAACATCAACAAGTGCATCTTCGGTGCGGAAGAAATACCGTTCCTCGACTGCTTCCTGGGGAAGGATAGCGTTCGGGCGGACCCCGAAAAGGT
CCAAGCTATATCGCAATGGCCGGTGCCGACATCCCACCGGGACTTGCGCAAGTGGCTTGGCTTCGCCAACTACTTGCACAAATATAGCGAGAACTACGCC
GAGTTGGCCAGGCCACTTACCAACCTTCTAAAAAAGGAGGCGGCGTGGTCCTGGACCGAGGAAGCTCAGTGGGCCTTTGAGGCTATCAAGCAGAGCTTAC
AGAGCGCGCCAATCCTGGCGCTACCAGACGGGGATCGTTCGTTTAGTGTCGTGTGCGACGCCTCGGACTTTTCCATCGGCTGCGCCCTCCGTCAGGTCGA
TGCCGACGGCAGGGAGCGCGTGGTCTCATTCCAATCGAGGCAGCTCAAAGCCGCGGAGAAGAACTACCCTGTTCATGACAAGGAACTCCTGGCGATGAAA
TACGCGCTAGTGAAGTTCAGGGTGCACCTGCTGGGCAGTAAGCCCTTCGTCATCTACACGGACCACGCATCACTGCGGACGGCGACCTCGTCGCCCCATC
TCTCGCAGCGCATGGCGCGTTGGCTTTCTTTCTTCGCTGAATACAACTTCACGGTGGTGCACAAGCCGGGAAAGCAGAACATCCTAGCGGACGCACTCTC
CTGGAGACCCGACTACGAGTTGGCACACGCTGTGTGTCTCGAATCATCGCTCTCTGAGCTAATTCGCAAAGCGTATGCCGAGGATGAGGAGCTGCGAGAT
CTGGTAGAAGCGCTGCGCGCTGATTCCGACGAAATCAAGCTGACAGCTCGTCAACGCGCGCGGTTGCACCGCTACACCCTCGCGAATGACCTCCTCTACT
ACCACGTAGATAAAGAGGACGAACCTCGGGTGGTCGTccccagcgacgaggacctgAGGCACCGAATCTTCTATGAGGCGCACGACACGCCGCTCAGCGG
TCACCTCGGAAGGGAAAAGACATACACGTCGGTGGCCAGGGACTATTAGTGGCCCCACATGTACAAATGGGTACGCTCTTACGTCAAGACTTGCAAGACC
TGTCAGCGAGTGAAACcggcgccttcgtcggcgGCCCCGCTAATGAGTCTGCCGGTACCGACTGATTGCTGGCGCTCAGTGAGCAtggacttcatcttcg
accCACCGCCCGATGGGCGAGGCCATACTGGCATCTTAGTCTTCGCATGTCGCCTGAGCAAGATGGTGCGGCTGGCGGCCGTGAAACGGAGTGTTACGGC
GCCAGAGGCGGCCCAGCACTTCACAGATAATGTCTTCCGTCATCACGGCCTCCCGGAGGCATTCGTCAGTGACCGAGACCCCCGCTTCGACTCTCATTTC
TGAAGGCACCTCTTCCGGCTGCTCGGTACGCAGCTGGACATGTCCACGGCGGACCATCCTCAGACCGATGGTCAAACCGAGCGAGTCAATCGCGTGTTAG