Description :
From Genome Similarity Track
Location :
Scaffold_1726:1- 1599
Transcript NameFunction/comments
Phyta_totarag13560hypothetical protein

Sequence
1598 bases(100 bases per row)
AGGTCCGTGATGAAGTCCATCGAGATTGAACGCCATCGTTCATCTGGAATCTGAGGTGGCTCCATCAGTCCAGGAGACTTCACTAGCCGCGGTTTGTTCT
GTCTGCAGTCTTCATAGCCAGCGATGTACTTCTTGATCGTACGCACCATACGCAGCCAATACCAGGCGGCATGAAGCTTCAGATATGTACGATCGGTGCC
AGGGTGTCCGCCGTAGTTGAATCGTGTGCTTCAGCGATGATACGATGCTTCAGCGCTACGGTGTTCGGAACCACAATTCGAGGTTTCTCGTCCGTCGACC
CTTGATACCAGATcaggttcttctcctcgaagtaCGGCTTGTACTGCTTCTCGGATGCGCCACGAGTTCTGGTAGGttcctcgcgcttcttgatctcgcg
TCGGATCTCTCGGATAATATTCTGCTTTGCGTAGCCAGCAATGACAGACTTGATCAAATCACTTGTGGGCTTGATCTCTGCAACGCGTAGTTGGTCGCTG
gtctcgttgaagttgggAAGGAGTAAGTCGTGAAACTCCTTCGTCTCTGGCTTGAGATCAGGTCGTCAACTAAGAGCATCAGCGATACCGTTCTTGGCTC
CGGGGAGATACGTGACTACGGACTGGTACTCGGCCATGATATCATACCAACGAGCTAGACGACGGTTTGCTATCATCTGCTGAAAGATACCTTCGAGAGA
CCTGTGGTCCGTCTCGATCATGACTGGTCGATCCAAGCAATAGATCCGGAAAGCTTCTAACGCATTGTCAATTGCGAgtagctcttgctgcagcgtggGT
ACTTCAGCTCTGCtgacttcatcttcgacttgtgAATACAATCGGTCGCTCGACACCGTCGGCAGCTTGGAACAaaacaccaccaacagcaaactGACTT
GCATTCGTTCGCaagtgcatctgctgcgtgaagtCGGGTAACTGTAGCACGGGGGTATTCGCCAGTCgacgcttgagctccttgaagttcttgagctgcg
cTGGACTCAACGTAATCTTCGAGTTGTgttggttcttcttctttaaCAGTGTGAACAATGAAGCTGTCAGCTTCGCGTACTGCTCACAAAAGCATTGCAC
GTATCCTGTCAAACCGAGAAAGCTATGAAGCTGTTCTGGTATTCGCGGGATAGGTCAGTCTCGAATCGTCTGCACCTTGTCGGGATCGATGCGAACTCCA
TTCCGGCCGATGAAATCGCCAAGGCACAGAACTCCTCAGCACAGAATACACACTTGGGCAACTTAACGTACagtttgttcttgttcaGAATTTCCAACAC
GTCCCGTAGAGTTCGCAGATGTTCGTTGATGTCCTTCCTTCGTAAACACGTAGATATCGTCTTAGAATGATCGCGTGTGTGGCGGATCCTCGAACAACGA
TAATGTCAAGCGATGCATCGTCGCCgacgcgttgctgaagcCCATCAGTAGCACCAGGTACTCGTACAATCCACTGGGCGCTTGGAATGCAGCGTACTTG
ACATGGTCCATCTTCATACGAACTTGGTAGTACGCCGACATCAGGTCCATGCACGAGAAGTAGTAGGCACCAGCCATACTGTCGAAAACATCCTCCTT